Annals of Oncology Advance Access originally published online on February 14, 2007
Annals of Oncology 2007 18(5):851-858; doi:10.1093/annonc/mdl502
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2007 European Society for Medical Oncology
breast cancer |
Circulating HER2 mRNA-positive cells in the peripheral blood of patients with stage I and II breast cancer after the administration of adjuvant chemotherapy: evaluation of their clinical relevance
1 Laboratory of Tumor Cell Biology, School of Medicine, University of Crete
2 Department of Medical Oncology, University General Hospital of Heraklion, Crete, Greece
* Correspondence to: Dr D. Mavroudis, Department of Medical Oncology, University General Hospital of Heraklion, PO Box 1352, Heraklion 711 10, Crete, Greece. Tel: +30-2810-392823; Fax: +30-2810-392802; E-mail: mavrudis{at}med.uoc.gr
| Abstract |
|---|
|
|
|---|
Background: The purpose of this study was to evaluate the prognostic value of circulating tumor cells (CTCs) expressing HER2 messenger RNA (mRNA) after the administration of adjuvant chemotherapy in women with operable breast cancer.
Patients and methods: HER2 mRNA-positive CTCs were detected by nested RT-PCR in the peripheral blood of 214 patients with stage I and II breast cancer after the completion of adjuvant chemotherapy.
Results: HER2 mRNA-positive CTCs were detected in 45 (21%) patients. Adjuvant chemotherapy could eliminate HER2 mRNA-positive CTCs in 16 (30.2%) prechemotherapy-positive patients. Moreover, HER2 mRNA-positive CTCs were detected in eight (5%) of 161 prechemotherapy-negative patients. The detection of HER2 mRNA-positive CTCs after chemotherapy was associated with reduced disease-free interval (DFI) (P = 0.006) but not with overall survival (P = 0.2); this effect was mainly observed in node-negative patients (P = 0.04) and to a lesser extent in node-positive (P = 0.06). Multivariate analysis revealed that the detection of HER2 mRNA-positive CTCs was an independent predictive factor for DFI (hazard ratio 3.238, P < 0.0005).
Conclusions: The detection of HER2 mRNA-positive CTCs after the completion of adjuvant chemotherapy may provide clinically useful information concerning the efficacy of treatment and the prognosis of patients with operable breast cancer.
Key words: adjuvant chemotherapy, CTCs, early breast cancer, HER2 mRNA, occult tumor cells
| introduction |
|---|
|
|
|---|
Disseminated occult tumor cells can be detected even in patients with early breast cancer; using immunohistochemistry or molecular techniques, several investigators have shown that epithelial cells can be identified in the bone marrow [disseminated tumor cells (DTCs)] aspirates or the peripheral blood [circulating tumor cells (CTCs)] of otherwise metastases-free patients with stage I and II breast cancer [1, 2]. The detection of occult tumor cells either in the bone marrow or the peripheral blood is associated with a high risk of distant relapse and poor overall survival (OS) [39]. A meta-analysis of nine studies involving 4703 patients with stage IIII breast cancer has demonstrated that the detection of DTCs is an independent prognostic factor for early relapse and death [10].
DTCs and CTCs could be identified in patients with breast cancer by using markers which are thought to be tissue specific and expressed on epithelial but not on hematopoietic cells. Among these markers are cytokeratin-19 (CK19), mammaglobin, maspin, carcinoembryonic antigen [39, 1115] and HER2 [16]. Indeed, immunophenotyping of both DTCs and CTCs revealed that they often express the HER2/c-neu (p185-erbB2) oncoprotein [1620]. In addition, HER2 messenger RNA (mRNA)-positive cells could be detected using a RT-PCR assay [21]. We recently evaluated a nested RT-PCR assay in order to detect circulating HER2 mRNA-positive cells in patients with early-stage breast cancer. Our results demonstrated that this RT-PCR assay was highly specific since HER2 mRNA transcripts could be identified only in RNA extracted from HER2-overexpressing breast cancer cell lines but not in RNA extracted from cells that do not express HER2 (myeloma, breast and colorectal carcinoma cell lines); in addition, HER2 mRNA-positive cells could be detected in the peripheral blood of patients with breast cancer but not of patients with benign fibroadenomas, colorectal cancer or female healthy blood donors. The detection of HER2 mRNA-positive cells was not correlated with the overexpression of HER2 on the primary tumor cells. Finally, double immunostaining and confocal microscopic analysis revealed that practically all HER2-positive cells also coexpressed cytokeratins while FISH analysis demonstrated that HER2-positive cells presented HER2 gene amplification (Apostolaki et al.).
Previous studies have shown that adjuvant chemotherapy fails to eliminate DTCs [22] and CTCs [23] as they can be detected using cytokeratins as a marker of occult tumor cells. The detection of cytokeratin-positive DTCs or CTCs after adjuvant chemotherapy has been associated with a poor clinical outcome in patients with early-stage breast cancer [22, 23]. The resistance of occult tumor cells to adjuvant chemotherapy has been attributed to their dormant status [24, 25]. The above observations indicate that the detection of DTCs and CTCs may be an important marker to follow in patients with early-stage breast cancer, because it may identify a subgroup of patients who are at high risk of relapse. Moreover, the detection of occult tumor cells during or/and after the adjuvant systemic treatment could help to identify those patients who may have a substantial clinical benefit from a secondary adjuvant treatment before the occurrence of overt metastasis.
To the best of our knowledge, there are no data in the literature concerning the evaluation of HER2 mRNA-positive occult tumor cells in the peripheral blood after the administration of adjuvant chemotherapy. In the present study, we prospectively analyzed a cohort of 214 patients with early-stage breast cancer for the presence of HER2 mRNA-positive CTCs after the completion of adjuvant chemotherapy. Our findings demonstrate that the detection of HER2 mRNA-positive CTCs was associated with a decreased disease-free interval (DFI), especially in patients without axillary lymph node involvement, and represented an independent prognostic factor for disease-free survival.
| patients and methods |
|---|
|
|
|---|
patients
Peripheral blood (10 ml in EDTA) was obtained from 214 patients with operable (stages I and II) breast cancer at least 34 weeks after the surgical resection of the primary tumor and before the initiation of adjuvant chemotherapy treatment, as well as after the completion of adjuvant chemotherapy and before the initiation of any adjuvant hormone or locoregional (adjuvant radiation) treatment. All patients had the tumor completely resected and dissection of ipsilateral axillary lymph nodes levels I and II. The expression of estrogen (ER) and progesterone (PR) receptors as well as that of HER2 molecule was routinely carried out in the primary tumor by immunohistochemistry. The HER2 scoring was carried out using the criteria recommended by DACO A/S for the Hercep test (membrane staining, 03+ intensity scale). Patients with breast-conserving surgery received radiation therapy and patients with ER/PR-positive tumors received 20 mg/day tamoxifen for 5 years. All patients received adjuvant chemotherapy with 5-fluorouracil (5-FU)/epirubicin/cyclophosphamide (n = 110), sequential docetaxel (Taxotere; Aventis Pharma, Collegville, USA) and epirubicin/cyclophoshamide (n = 61), cyclophosphamide/methotrexate/5-FU (n = 32) and other regimens (n = 11). At the time of enrollment onto the adjuvant treatment as well as at the time of completion of adjuvant chemotherapy, no patient showed any clinical or radiological evidence of metastatic disease. All patients were regularly followed every 3 months for the first 2 years, every 6 months for three additional years and yearly thereafter. All patients gave their written informed consent to participate in the study, which was approved by the Ethics and Scientific Committees of our Institution.
preparation of peripheral blood mononuclear cells
All blood samples were obtained at the middle of the vein puncture after the first 5 ml of blood was discarded, in order to avoid contamination of blood with epithelial cells from the skin during sample collection. Peripheral blood was diluted with phosphate-buffered saline (vol) and peripheral blood mononuclear cells (PBMCs) were obtained by gradient density centrifugation using FicollHypaque 1077 (Sigma-Aldrich, St Louis, MO) at 1200 g for 30 min at 4°C. The interface cells were carefully collected, washed twice and pelleted. Cell pellets were kept at 80°C until RNA extraction. Total RNA isolation was carried out by using Trizol LS reagent (Gibco, Life Sciences, BRL, Grand Island, NY) according to the manufacturer's instructions. All RNA preparation and handling steps took place in a laminar flow hood, under ribonuclease-free conditions. The isolated RNA was dissolved in diethylpyrocarbonate-treated water and stored at 80°C until used. RNA concentration was determined by absorbance readings at 260 nm (Hitachi U-2000, Tokyo, Japan). RNA integrity was tested by PCR amplification of the ß-actin housekeeping gene. RNA extracted from HER2-overexpressing breast cancer cell lines (SKBR3 and MCF-7) and COLO 205 cell line was used as positive and negative controls, respectively.
nested RT-PCR.
Reverse transcription of RNA was carried out with the Thermoscript RT-PCR system (Invitrogen, Paisley, UK). Complementary DNA (cDNA) was synthesized according to the manufacturer's instructions. Two different PCR reactions, with the respective negative controls, were carried out with each sample in order to amplify fragments of HER2 and ß-actin. The sequences of primers used for HER2 (synthesized by Gencet, Paris, France) were as follows: 5'TCCTCCTCGCCCTCTTGC3' (sense Her-2-A); 5'GCGGGTCTCCATTGTCTA3' (antisense Her-2-B); 5'AGCCGCGAGCACCCAAGT3' (sense Her-2-C); 5'ACCTGCTGAACTGGTGTATGCA3' (antisense Her-2-D) [20, 26]. To amplify cDNA, 5 µl was subjected to first PCR in 50 µl buffer [10 mM of HCL, buffer (pH 8.3), 50 mM KCL and 2.5 mM MgCl2] containing 1 mM deoxynucleotide triphosphate, 0.5 mM of primers (Her-2-A and Her-2-B) and 2.5 units platinum Taq DNA polymerase (Invitrogen). For the second round of amplification (nested RT-PCR) a 2 µl aliquot of first PCR product was added to the same PCR buffer with 1 mM deoxynucleotide triphosphate, 0.5 mM of primers (Her-2-C and Her-2-D) and 2.5 units platinum Taq DNA polymerase. The nested RT-PCR was carried out using a modified touchdown program as previously described [20, 26]. All PCR products were subjected to electrophoresis in agarose 2% gel, stained with ethidium bromide and photographed under UV conditions. In order to determine the sensitivity of the assay, MCF-7 and SKBR3 cells were mixed with normal PBMCs in a cell ratio ranging from 1 : 10 to 1 : 106, and total RNA was extracted from these cell dilutions and tested for HER2 mRNA by nested RT-PCR.
statistical analysis
The main tools of analysis were logistic regression [27, 28] and the Cox proportional hazards model [29] for outcomes related to point events and time variables, respectively. To select those factors with an independent significant influence on outcomes, both analyses were carried out in a stepwise (unconditional backward) fashion [28, 29]. Before the application of these methods, univariate analyses were carried out for a preliminary exploration of marked associations. Univariate analyses included contingency tables, t or MannWhitney U tests, log-rank tests and simple Cox regression analyses [3032].
| results |
|---|
|
|
|---|
patients' demographics
Table 1 presents the clinical characteristics of the study population according to the presence of HER2 mRNA-positive cells after the completion of adjuvant chemotherapy. The median age of the patients was 55 years and most of them (62.1%) were postmenopausal. One hundred and ten (51.4%) patients had grade III tumors, measuring
2 cm in 79.4% of patients, while 141 (65.8%) presented lymph node involvement (N+); in addition, 125 (58.4%) and 23 (10.7%) of the patients had ER-positive and HER2-positive (score 3+) tumors, respectively (Table 1). The median follow-up time for the entire group of patients was 72 months (range 5108).
|
detection of peripheral blood HER2 mRNA-positive cells
HER2 mRNA-positive CTCs could be detected in 53 (24.8%) and 45 (21%) out of 214 patients before the initiation of any adjuvant treatment and after the completion of adjuvant chemotherapy, respectively. In univariate analysis, there was no statistically significant association between the detection of HER2 mRNA-positive cells after chemotherapy and the patients' menstrual status, stage of the disease, size and histological grade of the tumor, number of involved axillary lymph nodes, ER or PR positivity and HER2 status of the primary tumor (Table 1).
Table 2 indicates the effect of adjuvant chemotherapy on the HER2 mRNA-positive CTCs; chemotherapy could decrease the number of HER2 mRNA-positive CTCs to undetectable levels in 16 (30.2%) of the 53 prechemotherapy HER2 mRNA-positive patients. In addition, eight (5%) patients who had no HER2 mRNA-positive CTCs before the initiation of adjuvant chemotherapy became positive after chemotherapy (Table 2).
|
clinical relevance of the detection of postchemotherapy HER2 mRNA-positive CTCs in patients with early breast cancer
relapse.
During the follow-up period, 51 (23.8%) patients developed distant metastases. The incidence of clinical relapses was significantly higher in patients with detectable than nondetectable HER2 mRNA-positive CTCs after the completion of adjuvant chemotherapy (40% versus 19.5% P = 0.004, Table 3). Univariate analysis confirmed these observations since the presence of HER2 mRNA-positive CTCs after the completion of adjuvant chemotherapy was associated with a decreased DFI [hazard ratio 2.197, 95% confidence interval (CI) 1.233.90, P = 0.006]; moreover, the presence of histology grade III (hazard ratio 2.226, 95% CI 1.234.02, P = 0.005) was also associated with decreased DFI. ER-negative tumors were associated with a decreased DFI but this marginally failed to reach statistical significance (Table 4). The median DFI for patients with detectable HER2 mRNA-positive CTCs postchemotherapy was 87 months (range 5104), although it has not been reached (range 9106) for patients without detectable HER2 mRNA-positive CTCs (log-rank test, P = 0.006) (Figure 1). The median DFI was 87 months (range 596) in patients with node-negative (N0) disease who had detectable HER2 mRNA-positive CTCs while it has not been reached (range 13106 months) in those without HER2 mRNA-positive CTCs (P = 0.041, Figure 1A). Conversely, there was no significant difference of median DFI in node-positive (N+) patients with (median DFI 81 months, range 9104) or without (median DFI not reached, range 9105) detectable HER2 mRNA-positive CTCs (P = 0.062, Figure 1B).
|
|
|
The multivariate application of the Cox proportional model yielded only three factors with significant independent influence on the DFI: the presence of HER2 mRNA-positive CTCs after the completion of adjuvant chemotherapy (hazard ratio 3.238, 95% CI 1.7775.898, P < 0.0005), four or more involved axillary lymph nodes (hazard ratio 2.728, 95% CI, 1.5174.907, P = 0.001) and histological grade III (hazard ratio 2.193, 95% CI, 1.1904.040, P = 0.012) (Table 5).
|
survival.
During the follow-up period, 31 (14.5%) patients died of breast cancer. The incidence of death was 20% (nine out of 45 patients) and 13% (22 out of 169 patients) in patients with and without detectable HER2 mRNA-positive CTCs after the completion of adjuvant chemotherapy, respectively (P = 0.237) (Table 3). As shown in Table 4, the involvement of four or more axillary lymph nodes (hazard ratio 2.996, 95% CI 1.466.14, P = 0.002) but not the detection of HER2 mRNA-positive CTCs after adjuvant chemotherapy were associated with decreased OS. The estimated median OS time for patients with detectable HER2 mRNA-positive CTCs was 108 months (range 10106) while it has not been reached in patients without HER2 mRNA-positive CTCs (range 13108 months) (log-rank test, P = 0.237, Figure 2). The probability of OS was not different between the patients with and without detectable HER2 mRNA-positive CTCs after the completion of adjuvant chemotherapy, irrespectively of the lymph node involvement status (patients with N0 disease: log-rank test, P = 0.286, Figure 2A; patients with N+ disease: log-rank test, P = 0.513, Figure 2B). The Cox proportional hazard analysis revealed that only the involvement of four or more axillary lymph nodes (hazard ratio 4.164, 95% CI 1.9249.015, P = 0.0003) was independently associated with reduced OS (Table 5).
|
combined analysis of pre- and postchemotherapy HER2 mRNA-positive CTCs in patients with early breast cancer
As shown in Table 2, 37 patients had HER2 mRNA-positive CTCs both pre- and postchemotherapy (pre+/post+), 16 patients were pre+/post, eight patients were pre/post+ and 153 were pre/post. The risk of relapse was 40.5%, 68.8%, 37.5% and 14.4% for pre+/post+, pre+/post, pre/post+ and pre/post, respectively (P = 0.001, P = 0.001, P = 0.078 for comparisons with the pre/post group, respectively). Figure 3 shows the disease-free survival for the four groups of patients according to the pre- and postchemotherapy HER2 mRNA status.
|
| discussion |
|---|
|
|
|---|
Several studies using cytokeratins as a marker of disseminated (DTCs) [37] or circulating (CTCs) [911, 32] occult tumor cells have shown that their detection is associated with an increased risk of relapse and reduced survival in patients with early-stage breast cancer. The HER2 oncoprotein could be an alternative marker for the detection of CTCs in patients with early breast cancer, since several studies have reported that cytokeratin-positive DTCs and CTCs frequently express the HER2 molecule [1620]. Our group has recently shown that the detection of HER2 mRNA-positive CTCs in early-stage breast cancer patients before the initiation of any systemic treatment was associated with a decreased DFI and OS. Furthermore, the multivariate analysis demonstrated that the detection of HER2 mRNA-positive CTCs before the initiation of adjuvant chemotherapy was an independent prognostic factor for DFI and OS (Apostolaki et al.).
In the current study, we evaluated the clinical relevance of HER2 mRNA-positive CTCs in patients with breast cancer after the completion of adjuvant chemotherapy. The results presented here indicate that the detection of HER2 mRNA-positive CTCs may serve as a surrogate marker for increased risk of relapse. Indeed, 21% of patients with early-stage breast cancer had HER2 mRNA-positive CTCs after the completion of adjuvant chemotherapy and their detection was not associated with other important clinical or pathological tumor parameters (Table 1); this may be explained by the biological behavior of specific clones of malignant cells which show an early hematogenous dissemination. This propensity for early hematogenous dissemination has been associated with increased tumor angiogenesis [33, 34] as well as other tumor-associated characteristics [2].
Our data demonstrate that adjuvant chemotherapy failed to decrease the frequency of HER2 mRNA-positive CTCs to undetectable levels in almost 70% of the patients with detectable HER2 mRNA-positive CTCs before the initiation of adjuvant treatment. This observation strongly indicates a lack of activity of the used chemotherapy regimens against HER2 mRNA-positive CTCs. A similar resistance of DTCs and CTCs to chemotherapy regimens has also been observed when cytokeratins were used as markers of occult tumor cells [22, 23]. It is, however, interesting to note that in those studies, chemotherapy could eliminate the cytokeratin-positive tumor cells in
50% of the patients while this was the case in only 30% of patients with HER2 mRNA-positive CTCs; although no direct comparisons could be made, this observation might indicate a higher resistance of HER2 mRNA-positive CTCs than cytokeratin-positive CTCs to chemotherapy. This lack of activity of chemotherapy on HER2 mRNA-positive CTCs may be attributed to the accumulating evidence that overexpression of the HER2 gene confers resistance to cytotoxic regimens; furthermore, it cannot be excluded that the low proliferation capacity and/or the dormant status of these cells may also account for this high resistance to chemotherapy [35].
The detection of HER2 mRNA-positive CTCs revealed important biological information. Indeed, their detection after the completion of adjuvant chemotherapy was associated with reduced DFI and the multivariate analysis demonstrated that the detection of HER2 mRNA-positive CTCs was an independent prognostic factor for reduced DFI. In the subgroup analysis, this effect was significant in patients with N0 but not with N+ disease, indicating that the detection of HER2 mRNA-positive CTCs after chemotherapy could be an important prognostic marker identifying a subgroup of N0 breast cancer patients who are at high risk for relapse. The treatment of these high-risk patients with a secondary adjuvant therapy could be of interest. Conversely, the detection of HER2 mRNA-positive cells after the completion of adjuvant chemotherapy was not associated with reduced survival, irrespectively of the axillary lymph node involvement status. This lack of association of HER2 mRNA-positive CTCs with survival should probably be attributed to the treatment that these patients received for their metastatic disease. Indeed, recent studies have shown that the decreased number of CTCs after the administration of treatment of metastatic disease is associated with a better median progression free and OS as compared with patients who continue to have high numbers of CTCs after chemotherapy [36, 37].
The results of the combined analysis according to the HER2 mRNA status before and after chemotherapy should be interpreted with caution because of the very small numbers of patients in each subgroup. Nevertheless, they clearly demonstrate that patients with a negative status both before and after chemotherapy fare better. The results of the combined analysis, however, do not provide any evidence of prediction of treatment efficacy according to the HER2 mRNA status after chemotherapy.
Since the presence of DTCs and CTCs is clearly associated with worse prognosis, it should be of great importance to develop therapeutic approaches to target these cells before the development of overt metastases. In this context, the detection of HER2 mRNA-positive CTCs may help to specifically target them with the anti-HER2 monoclonal antibody trastuzumab. Indeed, in a recent pilot study we demonstrated that trastuzumab could decrease the frequency of CK19-positive cells to undetectable levels in 28 out of 30 treated patients [20]. Prospective randomized clinical trials targeting the residual HER2 mRNA-positive occult tumor cells in patients with early-stage breast cancer are needed to evaluate the clinical benefit of such a CTC-targeted adjuvant therapeutic strategy.
| Acknowledgements |
|---|
|
|
|---|
Supported in part by the Cretan Association for Biomedical Research. AP and PK were recipients of a CABR clinical fellowship.
Received for publication October 5, 2006. Revision received December 5, 2006. Accepted for publication December 18, 2006.
| References |
|---|
|
|
|---|
1. Lambrechts AC, van Veer LJ, Rodenhuis S. The detection of minimal numbers of contaminating epithelial tumor cells in blood or bone marrow: use, limitations and future of RNA-based methods. Ann Oncol (1998) 9:12691276.
2. Pantel K, Cote RJ, Fodstad O. Detection and clinical importance of micrometastatic disease. J Natl Cancer Inst (1999) 91:11131124.
3. Cote RJ, Rosen PP, Lesser ML, et al. Prediction of early relapse in patients with operable breast cancer by detection of occult bone marrow micrometastatses. J Clin Oncol (1991) 9:17491756.[Abstract]
4. Braun S, Pantel K, Muller P, et al. Cytokeratin-positive cells in the bone marrow and survival of patients with stage I, II or III breast cancer. N Engl J Med (2000) 342:525533.
5. Diel IJ, Kaufmann M, Costa SD, et al. Micrometastatic breast cancer cells in bone marrow at primary surgery: prognostic value in comparison with nodal status. J Natl Cancer Inst (1996) 88:16525168.
6. Mansi JL, Easton D, Berger U, et al. Bone marrow micrometastases in primary breast cancer: prognostic significance after 6 years' follow-up. Eur J Cancer (1991) 27:15521555.[Web of Science][Medline]
7. Fields KK, Elfenbein GJ, Trudeau WL, et al. Clinical significance of bone marrow metastases detected using the polymerase chain reaction in patients with breast cancer undergoing high-dose chemotherapy and autologous bone marrow transplantation. J Clin Oncol (1996) 14:18681876.
8. Harbeck N, Untch M, Pache L, Eiermann W. Tumor cell detection in the bone marrow of breast cancer patients at primary therapy: results of a 3-year median follow-up. Br J Cancer (1994) 69:566571.[Web of Science][Medline]
9. Stathopoulou A, Vlachonikolis I, Mavroudis D, et al. Molecular detection of cytokeratin-19-positive cells in the peripheral blood of patients with operable breast cancer: evaluation of their prognostic significance. J Clin Oncol (2002) 20:34043412.
10. Braun S, Vogl FD, Naume B, et al. A pooled analysis of bone marrow micrometastasis in breast cancer. N Engl J Med (2005) 353:793802.
11. Xenidis N, Perraki M, Kafousi M, et al. Predictive and prognostic value of peripheral blood cytokeratic-19 mRNA positive cells detected by real time PCR in node-negative breast cancer patients. J Clin Oncol (2006) 24(23):37563762.
12. Zach O, Kasparu H, Krieger O, et al. Detection of circulating mammary carcinoma cells in the peripheral blood of breast cancer patients via a nested reverse transcriptase polymerase chain reaction assay for mammaglobin mRNA. J Clin Oncol (1999) 17:20152019.
13. Luppi M, Morselli M, Bandieri E, et al. Sensitive detection of circulating breast cancer cells by reverse-transcriptase polymerase chain reaction of maspin gene. Ann Oncol (1996) 7:619624.
14. Gerhard M, Juhl H, Kalthoff H, et al. Specific detection of carcinoembryonic antigen-expressing tumor cells in bone marrow aspirates by polymerase chain reaction. J Clin Oncol (1994) 12:725729.[Abstract]
15. Stathopoulou A, Mavroudis D, Perraki M, et al. Molecular detection of cancer cells in the peripheral blood of patients with breast cancer: comparison of CK-19, CEA and maspin as detection markers. Anticancer Res (2003) 23:18831890.[Web of Science][Medline]
16. Brandt B, Roetger A, Heidl S, et al. Isolation of blood-bone epithelium-derived c-erb-B2 oncoprotein-positive clustered cells from the peripheral blood of breast cancer patients. Int J Cancr (1998) 76:824828.[CrossRef]
17. Solomayer EF, Becker S, Pergolo-Becker G, et al. Comparison of HER2 status between primary tumor and disseminated tumor cells in primary breast cancer patients. Brest Cancer Res Treat (2006) 98(2):179184.[CrossRef]
18. Braun S, Schlimok G, Heumos I, et al. erbB2 overexpression on occult tumor metastatic cells in bone marrow predicts poor clinical outcome of stage I-II breast cancer patients. Cancer Res (2001) 61:18901892.
19. Wulfing P, Bochard J, Buerger H, et al. HER 2 positive circulating tumor cells indicate poor clinical outcome in stage I to III breast cancer patients. Clin Cancer Res (2006) 12:17151720.
20. Bozionellou V, Mavroudis D, Perraki M, et al. Trastuzumab administration can effectively target chemotherapy-resistant cytokeratin-19 messenger RNA-positive tumor cells in the peripheral blood and bone marrow of patients with breast cancer. Clin Cancer Res (2004) 10:81858194.
21. Wasserman L, Dreilinger A, Easter D, Wallace A. A seminested RT-PCR assay for HER2/neu: initial validation of a new method for the detection of disseminated breast cancer cells. Mol Diagn (1999) 4:2128.[CrossRef][Web of Science][Medline]
22. Braun S, Kentenich C, Janni W, et al. Lack of effect of adjuvant chemotherapy on the elimination of single dormant tumor cells in the bone marrow of high-risk breast cancer patients. J Clin Oncol (2000) 18:8086.
23. Xenidis N, Vlachonikolis I, Mavroudis D, et al. Peripheral blood circulating cytokeratin-19 mRNA-positive cells after the completion of adjuvant chemotherapy in patients with operable breast cancer. Ann Oncol (2003) 14:849855.
24. Pantel K, Dickmanns A, Zippelius A, et al. Establishment of micrometastatic carcinoma cell line: a novel source of tumor cell vaccines. J Natl Cancer Inst (1995) 87:11621168.
25. Uhr JW, Scheuermann RH, Street NE, Vitetta ES. Cancer dormancy: opportunities for new therapeutic approaches. Nat Med (1997) 3:505509.[CrossRef][Web of Science][Medline]
26. Thomas D, Giordano T, Sanders D, et al. Absence of HER2/neu gene expression in osteosarcoma and skeletal Ewing's sarcoma. Clin Cancer Res (2002) 8:788793.
27. Cox DR. The Analysis of Binary Data. (1970) London, UK: Methuen.
28. Collett D. Modeling Binary Data. (1999) London, UK: Chapman and Hall.
29. Collett D. Modeling Survival Data in Medical Research. (1994) London, UK: Chapman and Hall.
30. Altman GD. Practical Statistics for Medical Research. (1991) London, UK: Chapman and Hall.
31. Armitage P, Berry G. Statistical Methods in Medical Research, Third edition. (1994) Oxford, UK: Blackwell Scientific.
32. Aerts J, Wynendaele W, Paridaens R, et al. A real-time quantitative reverse transcriptase polymerase chain reaction (RT-PCR) to detect breast carcinoma cells in peripheral blood. Ann Oncol (2001) 12:3946.
33. Giatromanolaki A, Koukourakis MI, Kakolyris S, et al. Assessment of highly angiogenic and disseminated tumor cells in the peripheral blood disease in breast cancer patients predicts for resistance to adjuvant chemotherapy and early relapse. Int J Cancer (2004) 108:620627.[CrossRef][Web of Science][Medline]
34. Stathopoulos EN, Sanidas E, Kafousi M, et al. Detection of CK-19 mRNA-positive cells in the peripheral blood of breast cancer patients with histologically and immunohistochemically negative axillary lymph nodes. Ann Oncol (2005) 16:240246.
35. Pantel K, Schlimok G, Braun S, et al. Differential expression of proliferation-associated molecules in individual micrometastatic carcinoma cells. J Natl Cancer Inst (1993) 85:14191424.
36. Cristofanilli M, Budd GT, Ellis MJ, et al. Circulating tumor cells, disease progression, and survival in metastatic breast cancer. N Engl J Med (2004) 351:781791.
37. Cristofanilli M, Hayes DF, Budd GT, et al. Circulating tumor cells: a novel prognostic factor for newly diagnosed metastatic breast cancer. J Clin Oncol (2005) 23:14201430.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
N. KRAWCZYK, M. BANYS, H. NEUBAUER, E.-F. SOLOMAYER, C. GALL, M. HAHN, S. BECKER, R. BACHMANN, D. WALLWIENER, and T. FEHM HER2 Status on Persistent Disseminated Tumor Cells after Adjuvant Therapy May Differ from Initial HER2 Status on Primary Tumor Anticancer Res, October 1, 2009; 29(10): 4019 - 4024. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alix-Panabieres, S. Riethdorf, and K. Pantel Circulating Tumor Cells and Bone Marrow Micrometastasis Clin. Cancer Res., August 15, 2008; 14(16): 5013 - 5021. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ignatiadis, G. Kallergi, M. Ntoulia, M. Perraki, S. Apostolaki, M. Kafousi, G. Chlouverakis, E. Stathopoulos, E. Lianidou, V. Georgoulias, et al. Prognostic Value of the Molecular Detection of Circulating Tumor Cells Using a Multimarker Reverse Transcription-PCR Assay for Cytokeratin 19, Mammaglobin A, and HER2 in Early Breast Cancer Clin. Cancer Res., May 1, 2008; 14(9): 2593 - 2600. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Pantel, C. Alix-Panabieres, and S. Riethdorf Circulating Tumor Cells: Detection and Clinical Relevance Am. Assoc. Cancer Res. Educ. Book, April 12, 2008; 2008(1): 603 - 610. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





