Skip Navigation


Annals of Oncology Advance Access originally published online on October 30, 2006
Annals of Oncology 2007 18(2):311-316; doi:10.1093/annonc/mdl394
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/2/311    most recent
mdl394v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Liu, Y
Right arrow Articles by Zhou, R-L
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Y
Right arrow Articles by Zhou, R-L
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2006 European Society for Medical Oncology

gastrointestinal tumors

Relationship between LAPTM4B gene polymorphism and susceptibility of gastric cancer

Y Liu1, Q-Y Zhang2,*, N Qian2 and R-L Zhou3

1 The Medical School of Da Tong University, Shanxi Medical University, Taiyuan
2 Department of Clinical Laboratory, Peking University School of Oncology, Beijing Cancer Hospital and Institute
3 Department of Cell Biology, The School of Basic Medical Sciences, Peking University, Beijing, China

* Correspondence to: Dr Q.-Y. Zhang, Department of Clinical Laboratory, Peking University School of Oncology, Beijing Cancer Hospital and Institute, 52 Fucheng Road, Haidian District, 100036 Beijing, China. Tel: +86-010-88196336; E-mail: zhqy_208{at}163.com


    Abstract
 Top
 Abstract
 introduction
 materials and methods
 results
 discussion
 Acknowledgements
 References
 
Background: A novel gene called LAPTM4B (lysosome-associated protein transmembrane 4ß) was mapped to 8q22, and contains seven exons. The 2.25-kb messenger RNA of the gene encodes a putative lysosome-associated protein with four transmembrane regions. There are two alleles of the gene, named as LAPTM4B*1 and LAPTM4B*2. Allele *1 differs from allele *2 in that it contains only one copy of a 19-bp sequence in the 5' untranslated region (UTR), whereas this sequence is duplicated and tandemly arranged in allele *2. Studies showed that the allelic variation of LAPTM4B was associated with the genetic susceptibility of hepatocellular carcinoma but not with that of esophageal squamous cell carcinoma. This study was designed to investigate the possible association between the allelic variation of LAPTM4B and the genetic susceptibility of gastric cancer.

Materials and methods: The genotype of LAPTM4B was analyzed in 350 unrelated healthy adult individuals and 214 patients with gastric cancer by utilizing polymerase chain reaction based on specific primers. The genotypic distribution of LAPTM4B was analyzed by {chi}2 test.

Results: The allelic frequencies of the *2 were 33.88% and 24.14% in the gastric cancer group and the healthy control group, respectively, which was significantly different between the two groups (P < 0.001). There was a significant difference in the overall genotypic distribution between the patients and the controls (P = 0.023). The risk of suffering from gastric cancer was increased 1.819 times in the individuals of the *1/2 genotype [95% confidence interval (CI) 1.273–2.601] and 2.387 times in the individuals of the *2/2 genotype of LAPTM4B (95% CI 1.195–4.767) compared with the *1/1 genotype. No association between the genotypic distribution of LAPTM4B and the clinical information on patients of gastric cancer such as age, pathological type, differentiation classification of TNM, and infection of hepatitis B virus was shown.

Conclusion: This study indicated that allele *2 of LAPTM4B might be the risk factor of gastric cancer, which could be associated with genetic susceptibility of gastric cancer.

Key words: gastric cancer, gene polymorphism, LAPTM4B, susceptibility


    introduction
 Top
 Abstract
 introduction
 materials and methods
 results
 discussion
 Acknowledgements
 References
 
Lysosome-associated protein transmembrane 4ß (LAPTM4B), a novel gene overexpressed in most hepatocellular carcinomas (HCCs) and their cell lines, showed that up-regulation of the gene correlated significantly with differentiation of HCC. Deregulation of the gene may contribute to the development of HCC. The LAPTM4B fragment was first screened out by fluorescent differential-display polymerase chain reaction (PCR) [1], and confirmed by slot blot [24]. It was overexpressed in HCCs compared with paired noncancerous liver or normal liver tissues [5, 6]. Significantly high expression was also noticed in poorly differentiated HCCs when compared with moderately or well-differentiated HCCs. LAPTM4B was mapped to 8q22, and contains seven exons. The 2.25-kb messenger RNA (mRNA) of the gene encodes a lysosome-associated protein with four transmembrane regions.

There are two alleles of the gene, named as LAPTM4B*1 and LAPTM4B*2 (GenBank accession No.: AY219176 and AY219177, respectively). Allele *1 differs from allele *2 in that it contains only one copy of a 19-bp sequence in the 5'UTR, whereas this sequence is duplicated and tandemly arranged in allele *2. The mRNA of allele *1 can only start translation at nt 157, because there are in-frame stop codons at nt 40 and nt 103. The mRNA of allele *2 would start translation at nt 17 which would produce an extra stretch of amino acids at N-terminus of LAPTM4B.

Previous studies showed that the frequencies of LAPTM4B*2/2-type allele of HCC were significantly higher than the normal population which indicated that LAPTM4B*2/2 was associated with the genetic susceptibility of HCC [7] and its gene polymorphism was associated with the certain tumor particularity, but not all the genetic susceptibility of tumors was related with LAPTM4B gene.

Several studies have shown that LAPTM4B was highly expressed in gastric cancer tissues and less expressed in normal gastric tissues. The relationship between LAPTM4B gene polymorphism and susceptibility of gastric cancer, however, is still not clear. Previous studies suggested that the allelic variation of LAPTM4B was associated with the genetic susceptibility of HCC and lung cancer [8], but not with that of esophageal squamous cell carcinoma (ESC). The available information makes it plausible to hypothesize that there was possible association between the allelic variation of LAPTM4B and the genetic susceptibility of gastric cancer. Here we are showing the results of a case–control study to examine the hypothesis.


    materials and methods
 Top
 Abstract
 introduction
 materials and methods
 results
 discussion
 Acknowledgements
 References
 
cases
Eligible cases were newly diagnosed gastric cancer patients seen at Beijing Cancer Hospital from 1 January 2004 to 30 September 2005. The diagnosis of gastric cancer was based on the criteria of tumor, node, metastasis (TNM) classification system formulated by American Joint Committee on Cancer and International Union Against Cancer in 2003. Patients consented in writing to participate in the study. Pathology reports were obtained after gastric resection or upon discharge to confirm diagnoses of gastric cancer. We approached 280 consecutive patients with gastric cancer. For this LAPTM4B polymorphism study, high-quality genomic DNA isolated from blood from 214 patients was obtained.

controls
Eligible controls were healthy individuals recruited from the employees at Beijing Cancer Hospital and Medical Health Center in Peking University. They met the same eligibility criteria, except for never having a diagnosis or history of cancer. The nurse interviewer approached blood donors, explained the study, and asked them to read the study description and sign the informed consent form if they agreed to participate. For controls who were patients at Beijing Cancer Hospital, medical charts were examined to ensure that the individuals did not have a prior history of cancer. For other controls, their cancer history was asked in the face-to-face interview. A total of 350 potential participants were approached.

blood sample collection and storage
Two milliliters of blood sample was collected from cases and controls who were willing to donate samples for genotype assays. All blood specimens were stored in a –20°C freezer at the Department of Clinical Laboratory and Department of Immunology, the School of Oncology, Peking University.

DNA extraction
Genomic DNA from human peripheral white blood cells was isolated for LAPTM4B assays. Two milliliters of each blood sample was collected in EDTA tubes kept at –20°C. Then the blood was thawed in a water bath at room temperature and 1 ml was transferred to a centrifuge tube. To this, 0.5 ml of phosphate-buffered saline was added at room temperature. The blood was centrifuged at 3500 g for 15 minutes at room temperature. This step was repeated twice. Then the supernatant was removed, which contained lysed red cells, by aspiration. The pellet was resuspended in 0.5 ml of lysis buffer. The solution was incubated for 1 h at 37°C, and proteinase K (20 mg/ml) was added to a final concentration of 100 µg/ml. A glass rod was used to mix the enzyme solution gently into the viscous lysates of cells. The lysates were incubated in a water bath for 3 hours at 50°C. DNA isolation followed a standard phenol–chloroform extraction and ethanol precipitation procedure.

PCR analysis of LAPTM4B polymorphisms
Genotyping for the LAPTM4B was determined by PCR and agarose gel electrophoresis analysis using the specific primers P1 (forward) 5' GCCGACTAGGGGACTGGCGGA 3' (nt 72–92) and P2 (reverse) 5' CGAGAGCTCCGAGCTTCTGCC 3' (nt 255–275) [7]. PCR cycles were carried out in a Perkin–Elmer thermocycler with the following cycle conditions: initial denaturation at 95°C for 5 minutes following 35 cycles of denaturation at 94°C for 30 seconds, annealing at 62°C for 30 seconds, and extension at 72°C for 30 seconds. The final extension step was for 5 minutes at 72°C. Each PCR was done in a final reaction volume of 25 µl containing 100 ng of genomic DNA, 10 pmol of each of the forward and reverse primers, 0.2 mmol/l of each deoxynucleoside triphosphate, 1.5 mmol/l MgCl2, 50 mmol/l KCl, 10 mmol/l Tris–HCl (pH 8.3), and 2.5 U Taq DNA polymerase (Promega; Beijing, China). Human ß-actin was used as positive inner control. The forward primer was 5'-AACTGGGACGACATGGAGAA-3' and the reverse primer 5'-GGTAGTCAGTCAGGTCCC-3'. The PCR products were analyzed by separation in a 2% agarose gel and visualized with ethidium bromide. The homozygous *1 genotype was identified by a 204-bp band; the homozygous *2 genotype was identified by the presence of a 223-bp band. The heterozygous *1/*2 type exhibited the two bands, 204 and 223 bp. The ß-actin PCR product will be 318 bp long.

statistical analysis
Statistical Analysis Software Version 13.0 was used for all statistical analyses. The distribution of selected demographic variables was analyzed by {chi}2 test or Fisher's exact test was used when the number of variables expected per cell was less than five, and Fisher's exact test was used to determine the significance of the deviation. The corrected P values were obtained by multiplying the uncorrected P values with the number of comparisons; P < 0.05 was taken as the level of significance. The relationships between gastric cancer and putative risk factors were measured using odds ratios (ORs) and the 95% confidence intervals (CIs) that were derived from logistical regression analysis. Dummy variables were used to estimate the OR for each category of exposure in logistical regression analysis. On the basis of the distributions of variables and prior knowledge of the risk factors for gastric cancer, age, pathological type, differentiation classification of TNM, and infection of hepatitis B virus (HBV) were adjusted for in the logistic regression model. Stratified analysis was used to evaluate the potential interaction effects between LAPTM4B variant and smoking status. Departures from multiplicative interaction effects between LAPTM4B and other potential risk or protective factors were evaluated. The null hypotheses for multiplicativity were tested. Testing of the multiplicative interaction was done by the likelihood ratio test. Departure from multiplicative effects was assessed by inclusion of main effect variables and their product terms in the logistical regression model.


    results
 Top
 Abstract
 introduction
 materials and methods
 results
 discussion
 Acknowledgements
 References
 
We tested 214 gastric cancer subjects and 350 normal control subjects for the 19-bp polymorphism of the LAPTM4B gene. Three kinds of genotypes of the LAPTM4B polymorphisms were found (Figure 1). From Figure 1B, 204-bp band for homozygous genotype *1/1 and 223-bp band for homozygous genotype *2/2 could be seen. The heterozygous genotype *1/2 exhibited the two bands, that is 223- and 204-bp bands. The up band in each lane, which was ß-actin-positive control, showed 318-bp PCR product. The mean (± standard deviation) age of the case and control groups was 50.91 (±9.71) and 49.75 (±9.39) years, respectively. Characteristics of the case and control subjects are presented in Table 1. There were no significant statistical differences in age and gender between the case and control groups.


Figure 1
View larger version (41K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Genotyping of LAPTM4B. (A) Schematic representation of LAPTM4B promoter and exon 1. Exon 1 is depicted as box; black box indicates the 19-bp sequence. Primers loci are shown. The nucleotide sequence is numbered with the transcription start site as +1. Partial sequences at 5'UTR in first exon from both alleles are shown. Allele *1 contains one copy of the 19-bp sequence; allele *2 contains two copies of the 19-bp sequences which is tandemly arranged. (B) Analyzed by separation in a 2% agarose gel electrophoresis. Lane 1: DNA marker (200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, and 1500 bp); lane 2: *1/1 genotype; lanes 3, 5: *1/2 genotypes; and lane 4: *2/2 genotype.

 

View this table:
[in this window]
[in a new window]

 
Table 1. General characterization of case and control groups

 
A total of 214 gastric cancer subjects and 350 normal control subjects were investigated. The distribution of genotype frequencies of LAPTM4B gene promoter region polymorphism in gastric cancer and normal control subjects is illustrated in Table 2. There were no significant deviations from Hardy–Weinberg equilibrium in the two samples (gastric cancer patients and controls).


View this table:
[in this window]
[in a new window]

 
Table 2. Allelic frequencies and distribution of genotype of LAPTM4B gene polymorphisms in case and control groups

 
To examine the effect of having at least one *2 allele on the risk of gastric cancer, we found that the adjusted OR of *2/2 and *1/2 versus genotype *1/1 was 1.887 (95% CI 1.337–2.664).

The allelic frequencies of the *2 were 33.88% and 24.14% in the gastric cancer group and the healthy control group, respectively, which was significantly different between the two groups (P < 0.001). There was a significant difference in the overall genotypic distribution between the patients and the controls (P = 0.023). (These data are not shown in the table since it is difficult to put in. It was done by t-test.) The risk of suffering from gastric cancer was increased 1.819 times in the individuals of the *1/2 genotype (95% CI 1.273–2.601) and 2.387 times in the individuals of the *2/2 genotype of LAPTM4B (95% CI 1.195–4.767) compared with the *1/1 genotype.

We detected a significant difference in the distribution of the *2/2 genotype in the LAPTM4B gene between gastric cancer patients and normal controls (P = 0.014). The frequency of the homozygote for the *2 allele, which was with the two copies of the 19-bp sequences in the LAPTM4B, increased significantly in gastric cancer patients, compared with normal controls (P < 0.001).

In addition, the association between allele frequencies and genotypes of the patients was investigated on one hand and the genotypic distribution of LAPTM4B in relation to clinicopathological and other variables in case group, such as age, pathological type, differentiation classification of TNM, and infection of HBV, was done on the other hand (Table 3). After adjusting for age, smoking, and drinking, no significant association was observed. No association was found between the genotypic distribution of LAPTM4B and the clinical information on patients of gastric cancer such as age, pathological type, differentiation classification of TNM, and infection of HBV.


View this table:
[in this window]
[in a new window]

 
Table 3. Distribution of genotypes of LAPTM4B in relation to clinicopathological and other variables in case group

 

    discussion
 Top
 Abstract
 introduction
 materials and methods
 results
 discussion
 Acknowledgements
 References
 
Studies showed that LAPTM4B was an important novel gene associated with proliferation and differentiation of cells. In normal cells, it may also play important roles such as regulation of cell proliferation and survival. LAPTM4B was widely expressed in human tissues. Its expression was high in heart, skeletal muscle, kidney, and testis; moderate in ovary, kidney, and pancreas; low in liver, spleen, and thymus; but lowest in lung and peripheral leukocytes. Furthermore, the expression levels of LAPTM4B were significantly related to the differentiation status of HCCs. Its expression was highest in poorly differentiated HCCs, high in moderately differentiated HCCs, and low in well-differentiated HCCs [912]. Furthermore, the phenomenon that LAPTM4B was highly overexpressed in a variety of human tumors, with the strongest expression levels in ovary and uterus, being similar with many oncogenes. These results strongly indicated that LAPTM4B might play important roles in initiation, promotion, and metastasis of tumor [7, 13].

Previous studies showed that the HCCs group with *2/2 genotype had a significantly increased risk of gastric cancer compared with normal group with *2/2 genotype (OR = 2.888) [7]. The genotype of LAPTM4B was analyzed in 350 unrelated healthy adult individuals and 214 patients with gastric cancer by utilizing PCR based on special primers. The allelic frequency of the *2 was 33.88% and 24.14% in the gastric cancer group and the healthy control group, respectively, which was significantly different between the two groups (P < 0.001). The gastric cancer group with *2/2 genotype showed a significantly increased risk of gastric cancer compared with normal group with *2/2 genotype (OR = 2.387; 95% CI = 1.195–4.767; P = 0.014). These results showed that allele *2 was associated with genetic susceptibility of gastric cancer. No difference, however, was observed in the frequencies of LAPTM4B genotypes in patients with ESC comparing with the corresponding controls, indicating that allele *2 was associated specifically with the susceptibility of the certain tumors.

The two sequence alleles of the LAPTM4B are in homology except that the 19-bp sequences at 5'UTR in the first exon. So the conclusion that different allele brings different susceptibility of gastric cancer only attributes to the 19-bp sequences. First, it was demonstrated that the promoter activity of the gene was repressed by 19% in allele *2 when compared with allele *1, suggesting that the 19-bp sequence is a potential negative regulatory cis-acting element which may contribute to the regulation of transcription of the gene. Additionally, allele *2 could predict a protein of 370 amino acids which contains 53 extra amino acids in the N-terminus than that of allele *1 (Figure 2, adapted from Deng et al. [8]), and this may provide a substantial basis for the relationship between LAPTM4B genotypes and susceptibility of HCC and lung cancer. Secondly, the researchers showed that the N-terminus of LAPTM4B protein sequence is the molecularly important function zone; it possibly plays the vital role in the cell signal conduction and matches ligand and acceptor. Therefore, the amino acids (53 aa) at N-terminus of LAPTM4B possibly caused the protein activation to be different; even the archery target change in the function occurs. Thirdly, this 19-bp difference possibly takes one cis-acting element with some transcription factor or nucleus, one or two copies in the LAPTM4B gene play the different regulative roles, cause different expression spot and level.


Figure 2
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Comparison of the putative proteins encoded by LAPTM4B*1 and LAPTM4B*2. Only partial sequences of the first exon are shown. The sequence numbers of the first nucleotide (left) and the final amino acid (right) in each row are indicated. The nucleotide sequences are numbered with the putative transcription start site as +1. In-frame stop codons are underlined and marked by symbols #, the 19-bp sequences in both of the alleles are underlined. Messenger RNA (mRNA) of allele *1 can only start translation at nt 157, because there are in-frame stop codons at nt 40 and nt 103. The mRNA of allele *2 would start translation at nt 17 which would produce an extra stretch of amino acids (53 aa, gray-shaded letters) at N-terminus of LAPTM4B.

 
The analogue LAPTM4A in murine is a nucleoside transporter on intracellular membrane-bound compartments, and mediates a multidrug-resistance phenotype in drug-sensitive strains of Saccharomyces cerevisiae [1417]. It is a highly conserved polytopic membrane protein present in mammalian lysosomes and endosomes [14, 16]. It is a member of the mammalian four transmembrane-spanning protein super family [17]. The mammalian LAPTM family currently consists of LAPTM4A, LAPTM4B, and LAPTM5 [1822]. Like LAPTM4A and LAPTM5, LAPTM4B contains a hydrophobic C-terminus. Within this C-terminal part, both LAPTM4 proteins contain four tyrosine-based motifs (YXX{Phi}) and a single valine–leucine (VL) motif. By analyzing fusion proteins, it was shown that the cytoplasmic C-terminus of LAPTM4A is necessary and sufficient for a correct targeting of the protein to lysosomes [23]. Moreover, the VL motif seems to play an indirect role in protein trafficking by regulating exposure of the signal to their cognate adaptor complexes [24]. Besides being proline rich, the N-terminal stretch of LAPTM4B contains a PXXP motif flanked by hydrophobic residues. As this is characteristic for ligands of src-homology 3 domains such as phosphatidylinositol 3-Kinase, protein phosphatase 2A, and protein kinase C, LAPTM4B is likely to interact with further downstream target proteins [4]. In summary, these data indicate an involvement of LAPTM4B in signal transduction pathway.

The putative protein of LAPTM4B is highly conserved, with 92% identity at the amino acid level to a murine LAPTM4B. It is also 46% homologous at the amino acid level to a human lysosome-associated transmembrane-4 protein, LAPTM4A. LAPTM4B shares a number of characteristics with other lysosome-associated proteins such as LAPTM5 [18]. These clues inspired us to investigate the functions of LAPTM4B and its roles in hepatocarcinogenesis.

LAPTM4B-overexpressing NIH3T3 cells displayed an increased cell growth and proliferation, reduced serum dependence, as well as changes in cell morphology [25]. Therefore, the LAPTM4B gene possibly promotes the cell cycle from G1 to S by cyclin E [26], accelerates cell proliferation, and promotes cell malignancy. Therefore, LAPTM4B-different genotypes maybe directly or indirectly cause the individual to have different tumor sensitiveness by the above way.

Gastric cancer is a major health problem and the leading cause of cancer deaths in the world [27]. Tumorigenesis is a multistep process accompanied by genetic alterations of precancerous cells and, simultaneously, by building up of the microenvironment which promotes transformation [2830]. Therefore, further elucidation of the role of LAPTM4B gene in the gastric cancer will require genotyping in additional samples and combined analysis across different studies.


    Acknowledgements
 Top
 Abstract
 introduction
 materials and methods
 results
 discussion
 Acknowledgements
 References
 
The authors thank all the subjects who participated in this study. This study was supported by the Key Project of Beijing Natural Science Fund (7041003), Beijing, China.

Received for publication February 2, 2006. Revision received September 13, 2006. Accepted for publication September 14, 2006.


    References
 Top
 Abstract
 introduction
 materials and methods
 results
 discussion
 Acknowledgements
 References
 
1. Zhang J, Liu JJ, Zhang N, et al. (2001) Screening of novel hepatocellular carcinoma-associated genes. J Beijing Med Univ 33:54–57.

2. Liu JJ, Zhang J, Zhang N, et al. (2000) Identification of new hepatocellular carcinoma related genes by fluorescent differential display. J Beijing Med Univ 32:411–414.

3. Liu JJ, Zhang J, Zhou RL, et al. (2000) Partial cloning of LHS cDNA and effect of its expression on behavior of hepatocellular carcinoma cells. J Beijing Med Univ 32:526–529.

4. Shao GZ, Zhou RL, Zhang QY, et al. (2003) Molecular cloning and characterization of LAPTM4B, a novel gene upregulatively expressed in hepatocellular carcinoma. Oncogene 22:5060–5069.[CrossRef][ISI][Medline]

5. Peng FY, Zhang QY, Zhou RL, et al. (2005) Construction of LAPTM4B promoter-luciferase reporter recombinants. J Chongqing Med Univ 30:337–339.

6. Morris DG, Musat M, Czirjak S, et al. (2005) Differential gene expression in pituitary adenomas by oligonucleotide array analysis. Eur J Endocrinol 153:1143–151.[Abstract/Free Full Text]

7. Shao GZ. (2003) Molecular cloning and characterization of LAPTM4B, a novel gene upregulated in hepatocellular carcinoma PhD paper. The School of Medical Sciences, Peking University.

8. Deng LJ, Zhang QY, Zhou RL, et al. (2005) Relationship between LAPTM4B gene polymorphism and susceptibility of lung cancer. J Peking Univ Health Sci 37:302–305.

9. Liu JJ, Zhou RL, Zhang N, et al. (2000) Biological function of a novel gene overexpressed in human hepatocellular carcinoma. Chin Med J (Engl) 113:881–885.

10. Liu XR, Zhou RL, Zhang QY, et al. (2003) Identification and characterization of LAPTM4B encoded by a human hepatocellular carcinoma-associated novel gene. J Beijing Med Univ 35:340–347.

11. Liu XR, Zhou RL, Zhang QY, et al. (2004) Structure analysis and expression of a novel tetratransmembrane protein, LAPTM4B associated with hepatocellular carcinoma. World J Gastroenterol 10:111555–1559.[Medline]

12. Peng C, Zhou RL, Shao GZ, et al. (2005) Expression of lysosome-associated protein transmembrane 4B-35 in cancer and its correlation with the differentiation status of hepatocellular carcinoma. World J Gastroenterol 11:182704–2708.[Medline]

13. Kasper G, Vogel A, Klaman I, et al. (2005) The human LAPTM4b transcript is upregulated in various type of solid tumors and seems to play a dual functional role during tumor progression. Cancer Lett 224:93–103.[ISI][Medline]

14. Hogue DL, Ellison MJ, Young JD, et al. (1996) Identification of a novel membrane transporter associated with intracellular membranes by phenotypic complementation in the yeast Saccharomyces cerevisiae. J Biol Chem 271:9801–9808.[Abstract/Free Full Text]

15. Yu WD, He X, Liu GS, et al. (2004) Identification and analysis of stage-specific expression of lysosome-associated protein transmembrane 4a gene during development of preimplantation rabbit nuclear transfer embryo. Mol Reprod Dev 68:415–421.[CrossRef][ISI][Medline]

16. Hogue DL, Kerby L, Ling V. (1999) A mammalian lysosomal membrane protein confers multidrug resistance upon expression in Saccharomyces cerevisiae. J Biol Chem 274:1812877–12882.[Abstract/Free Full Text]

17. Cabrita MA, Hobman TC, Hogue DL, et al. (1999) Mouse transporter protein, a membrane protein that regulates cellular multidrug resistance, is localized to lysosomes. Cancer Res 59:4890–4897.[Abstract/Free Full Text]

18. Adra CN, Zhu S, Ko JL, et al. (1996) LAPTM5: a novel lysosomal-associated multispanning membrane protein preferentially expressed in hematopoietic cells. Genomics 35:328–337.[CrossRef][ISI][Medline]

19. Altschul SF, Madden TL, Schaffer AA, et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402.[Abstract/Free Full Text]

20. Origasa M, Tanaka S, Suzuki K, et al. (2001) Activation of a novel microglial gene encoding a lysosomal membrane protein in response to neuronal apoptosis. Mol Brain Res 88:1–13.[Medline]

21. Hayami Y, Iida S, Nakazawa N, et al. (2003) Inactivation of the E3/LAPTm5 gene by chromosomal rearrangement and DNA methylation in human multiple myeloma. Leukemia 17:1650–1657.[CrossRef][ISI][Medline]

22. Scott LM, Mueller L, Collins SJ. (1996) E3, a hematopoietic-specific transcript directly regulated by the retinoic acid receptor alpha. Blood 88:72517–2530.[Abstract/Free Full Text]

23. Hogue DL, Nash C, Ling V, et al. (2002) Lysosome associated protein transmembrane 4 alpha (LAPTM4 alpha) requires two tandemly arranged tyrosine-based signals for sorting to lysosomes. J Biochem 365:721–730.

24. Colland F, Jacq X, Trouplin V, et al. (2004) Functional proteomics mapping of a human signaling pathway. Genome Res 14:1324–1332.[Abstract/Free Full Text]

25. He J, Shao GZ, Zhou RL. (2003) Effects of the novel gene, LAPTM4B, highly expression in hepatocellular carcinoma on cell proliferation and tumorigenesis of NIH3T3 cells. J Beijing Med Univ 35:348–352.

26. Carsten MT, Diederichs S, Schrader MG, et al. (2003) Cyclin A1 is highly expressed in aggressive testicular germ cell tumors. Cancer Lett 190:89–95.[CrossRef][ISI][Medline]

27. Kim H, Park JH, Bang SJ, et al. (2005) A phase II study of docetaxel and cisplatin in patients with gastric cancer recurring after or progressing during 5-FU/platinum treatment. Jpn J Clin Oncol 35:12727–732.[Abstract/Free Full Text]

28. Fearon ER and Vogelstein B. (1990) A genetic model for colorectal tumorigenesis. Cell 61:759–767.[CrossRef][ISI][Medline]

29. Hanahan D and Weinberg RA. (2000) The hallmarks of cancer. Cell 100:57–70.[CrossRef][ISI][Medline]

30. Ronnov-Jessen L, Petersen OW, Bissel MJ. (1996) Cellular changes involved in conversion of normal to malignant breast: importance of the stromal reaction. Physiol Rev 76:69–125.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Ann OncolHome page
X.-J. Cheng, W. Xu, Q.-Y. Zhang, and R.-L. Zhou
Relationship between LAPTM4B gene polymorphism and susceptibility of colorectal and esophageal cancers
Ann. Onc., March 1, 2008; 19(3): 527 - 532.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/2/311    most recent
mdl394v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Liu, Y
Right arrow Articles by Zhou, R-L
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Y
Right arrow Articles by Zhou, R-L
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?