Annals of Oncology 2007 18(11):1916; doi:10.1093/annonc/mdm479
© 2007 European Society for Medical Oncology
errata |
Circulating HER2 mRNA-positive cells in the peripheral blood of patients with stage I and II breast cancer after the administration of adjuvant chemotherapy: evaluation of their clinical relevance
Ann Oncol 2007; 18: 851–858An uncorrected version of the section entitled nested RT-PCR was published. The correct paragraph is given below.
nested RT-PCR. Reverse transcription of RNA was carried out with the Thermoscript RT-PCR system (Invitrogen, Paisley, UK). cDNA was synthesized according to the manufacturer's instructions. Two different PCR reactions, with the respective negative controls, were performed with each sample in order to amplify fragments of HER2 and ß-actin. The sequences of primers used for HER2 (synthesized by Gencet, Paris, France) were as follows: 5'TCCTCCTCGCCCTCTTGC3' (sense Her-2-A); 5'GCGGGTCTCCATTGTCTA3' (antisense Her-2-B); 5'AGCCGCGAGCACCCAAGT3' (sense Her-2-C); 5'TTGGTGGGCAGGTAGGTGAGTT3' (antisense Her-2-D) (20,26). To amplify cDNA, 2 µl were subjected to first PCR in 50 µl buffer [10mM of HCL, buffer (pH 8.3), 50 mM KCL and 2.5mM MgCl2] containing 1mM deoxynucleotide triphosphate, 3 mM of primers (Her-2-A and Her-2-B) and 2.5 units platinum Taq DNA polymerase (Invitrogen). For the second round of amplification (nested RT-PCR) a 1 µl aliquot of first PCR product was added to the same PCR buffer with 1mM deoxynucleotide triphosphate, 3 mM of primers (Her-2-C and Her-2-D) and 2.5 units platinum Taq DNA polymerase. The nested RT-PCR was performed using a modified touchdown program as previously described [20,26]. All PCR products were electrophoresed in agarose 2% gel, stained with ethidium bromide and photographed under UV conditions. In order to determine the sensitivity of the assay, MCF-7 and SKBR3 cells were mixed with normal PBMCs in a cell ratio ranging from 1:10 to 1:106, and total RNA was extracted from these cell dilutions and tested for HER2 mRNA by nested RT-PCR.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||