Annals of Oncology Advance Access originally published online on May 3, 2005
Annals of Oncology 2005 16(8):1253-1267; doi:10.1093/annonc/mdi239
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2005 European Society for Medical Oncology
Antitumoral actions of the anti-obesity drug orlistat (XenicalTM) in breast cancer cells: blockade of cell cycle progression, promotion of apoptotic cell death and PEA3-mediated transcriptional repression of Her2/neu (erbB-2) oncogene
1 Department of Medicine, Breast Cancer Translational Research Program, Evanston Northwestern Healthcare Research Institute, Evanston, Illinois; 2 Department of Medicine, Northwestern University Feinberg School of Medicine, The Lurie Comprehensive Cancer Center, Chicago, Illinois, USA
* Correspondence to: Dr J. A. Menendez or Dr R. Lupu, Department of Medicine, Northwestern University Feinberg School of Medicine, The Lurie Comprehensive Cancer Center, Chicago, Illinois, USA. Tel: +1-2243647672; Fax: +1-847-570-8022; E-mail: jmenendez{at}enh.org; r.lupu{at}northwestern.edu
| Abstract |
|---|
|
|
|---|
Background:: Orlistat (XenicalTM), a US Food and Drug Administration (FDA)-approved drug for bodyweight loss, has recently been demonstrated to exhibit antitumor properties towards prostate cancer cells by virtue of its ability to block the lipogenic activity of fatty acid synthase (FAS). FAS (oncogenic antigen-519) is up-regulated in about 50% of breast cancers, is an indicator of poor prognosis, and has recently been functionally associated with the Her2/neu (erbB-2) oncogene.
Materials and methods:: We assessed the antitumoral effects of orlistat against the human breast cancer cell line SK-Br3, an in vitro paradigm of FAS and Her2/neu overexpression in breast cancer.
Results:: Cell cycle analyses revealed that micromolar concentrations of orlistat induced, in a time- and dose-dependent manner, significant changes in the distribution of cell populations including a complete loss of G2-M phase, S-phase accumulation and a concomitant increase in the emerging sub-G1 (apoptotic) cells. Poly (ADP-ribose) polymerase (PARP) cleavage, an early event required for cells committed to apoptosis, was more predominant in orlistat-treated G1 phase cells. When we characterized signaling molecules participating in the cellular events following orlistat-induced inhibition of FAS activity and preceded inhibition of breast cancer cell proliferation, a dramatic down-regulation of Her2/neu-coded p185Her2/neu oncoprotein was found in orlistat-treated SK-Br3 cells (>90% reduction). Interestingly, a significant accumulation of the DNA-binding protein PEA3, a member of the Ets transcription factor family that specifically targets a PEA3-binding motif present on the Her2/neu gene promoter and down-regulates its activity, was observed in orlistat-treated SK-Br3 cells. When a Luciferase reporter gene driven by the Her2/neu promoter was transiently transfected in SK-Br3 cells, orlistat exposure was found to dramatically repress the promoter activity of Her2/neu gene, whereas a Her2/neu promoter bearing a mutated binding DNA sequence was not subject to negative regulation by orlistat, thus demonstrating that the intact PEA3 binding site on the Her2/neu promoter is required for the orlistat-induced transcriptional repression of Her2/neu overexpression. RNA interference (RNAi)-mediated silencing of FAS gene expression similarly repressed Her2/neu gene expression in a PEA3-dependent manner, thus ruling out a role for non-FAS orlistat-mediated effects. When the combination of orlistat and the anti-Her2/neu antibody trastuzumab (HerceptinTM) in either concurrent (orlistat + trastuzumab) or sequential (orlistat
trastuzumab; trastuzumab
orlistat) schedules was tested for synergism, addition or antagonism using the combination index (CI) method of ChouTalalay, co-exposure of orlistat and trastuzumab demonstrated strong synergistic effects (CI1090 = 0.1100.847), whereas sequential exposure to orlistat followed by trastuzumab (CI1090 = 0.3801.210) and trastuzumab followed by orlistat (CI1090 = 0.6051.278) mainly showed additive or antagonistic interactions. Indeed, orlistat-induced FAS inhibition synergistically promoted apoptotic cell death when concurrently combined with trastuzumab as determined by an ELISA for histone-associated DNA fragments. Importantly, the degree of FAS expression in a panel of human breast cancer cell lines was predictive of sensitivity to orlistat-induced anti-proliferative effects as determined by a MTT-based characterization of metabolically viable breast cancer cells. Moreover, hypersensitivity to orlistat-induced cytotoxicity was observed in MCF-7 breast cancer cells engineered to overexpress Her2/neu (MCF-7/Her2-18 cells), which exhibit a significant up-regulation of FAS expression and activity.
Conclusions:: These findings reveal that the development of more potent and/or bioavailable orlistat's variants targeting the lipogenic activity of FAS may open a novel therapeutic avenue for treating Her2/neu-overexpressing breast carcinomas.
Key words: orlistat, fatty acid synthase, Her2/neu, PEA3, trastuzumab, breast cancer
| Introduction |
|---|
|
|
|---|
An intense public interest has been generated by the characterization of the US Food and Drug Administration (FDA)-approved anti-obesity drug, orlistat (tetrahydrolipstatin; marketed by Roche as XenicalTM), an irreversible inhibitor of pancreatic and gastric lipases [1
As a part of our efforts to assess the role of FAS signaling on the survival and proliferation of breast cancer cells, we recently identified a novel bi-directional molecular linkage between breast cancer-associated FAS activity and Her2/neu (erbB-2), a well-characterized oncogene that is overexpressed in about 30% of breast carcinomas [26
28
]. First, when FAS protein expression was characterized in a wide panel of human breast cancer cell lines, a positive correlation was found between high levels of FAS [29
]. Secondly, Her2/neu overexpression stimulates the FAS gene promoter and ultimately mediates increased endogenous fatty acid biosynthesis, and this Her2/neu-induced FAS up-regulation is inhibitable by Her2/neu inhibitors such as trastuzumab [30
32
]. Thirdly, pharmacological and RNA interference (RNAi)-induced inhibition of FAS activity and expression, respectively, negatively regulates Her2/neu oncogene expression at the transcriptional level [33
]. Fourth, the degree of Her2/neu oncogene expression in a panel of breast cancer cell lines did predict sensitivity to chemical FAS inhibitors-induced cytotoxicity [34
]. These findings, altogether, strongly suggest that a previously unrecognized bi-directional cross-talk between FAS and Her2/neu is taking place in human breast cancer cells.
The objective of the present study was four-fold. First, we sought to characterize the antitumoral effects of the ß-lactone orlistat towards SK-Br3 breast cancer cells, which naturally overexpress orlistat target (i.e. FAS). Secondly, the ability of orlistat to block the thioesterase function of FAS was employed as an independent strategy to confirm that pharmacological inhibition of breast cancer-associated FAS activity, regardless of the mechanism of action of the chemical FAS blocker, is accompanied by the specific suppression of Her2/neu oncogene overexpression. Thirdly, we sought to elucidate the ultimate molecular mechanism through which FAS blockade leads to the suppression of Her2/neu oncogene overexpression in breast cancer cells. Fourthly, we evaluated the therapeutic value of combining orlistat and the monoclonal antibody against Her2/neu trastuzumab (HerceptinTM). Finally, we explored the correlation of orlistat-induced cytotoxicity with the status of FAS and Her2/neu expression in a wide panel of human breast cancer cell lines.
Although orlistat possesses extremely low oral bioavailability and it is obvious that a novel formulation will be required for treating tumors such as breast carcinomas, the findings of this study may open a new avenue for the development of more potent and/or bioavailable orlistat's variants targeting FAS as suitable drug candidates for the management of Her2/neu-overexpressing breast carcinomas.
| Materials and methods |
|---|
|
|
|---|
Cell lines and culture conditions
The human breast cancer cell lines SK-Br3, BT-474, MDA-MB-453, MDA-MB-435, MDA-MB-231, T47D and MCF-7 were obtained from the American Type Culture Collection (ATCC). Her2/neu-overexpressing MCF-7/Her2 (clone 18) cells and their matched control (empty vector-transfected) MCF-7/neo cells were provided by Mien-Chie Hung (The University of Texas MD Anderson Cancer Center, Houston, TX, USA). Breast cancer cell lines were routinely grown in phenol-red containing improved MEM (IMEM; Biosource International, Camarillo, CA, USA) containing 5% (v/v) heat-inactivated fetal bovine serum (FBS) and 2 mM L-glutamine. Cells were maintained at 37°C in a humidified atmosphere of 95% air/5% CO2. Cells were screened periodically for Mycoplasma contamination.
Materials
Trastuzumab (HerceptinTM) and orlistat (XenicalTM) were kindly provided by the Evanston Northwestern Healthcare Hospital Pharmacy (Evanston, IL, USA). Trastuzumab was solubilized in bacteriostatic water for injection containing 1.1% benzyl alcohol (stock solution 21 mg/ml), stored at 4°C and used within 1 month. Orlistat was extracted from XenicalTM capsules (Roche Applied Sciences) by solubilizing each pill in 1 ml of ethanol. Insoluble product was removed by centrifugation (14 000 x g for 5 min). The supernatant yielded a solution of orlistat (250 mM), which was aliquoted and stored at 80°C until use.
The mouse monoclonal antibodies for p185Her2/neu (Ab-3 and Ab-5 clones) were from Oncogene Research Products (San Diego, CA, USA). Anti-ß-actin goat polyclonal and anti-PEA3 (sc-113) mouse monoclonal antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The anti-PARP p85 fragment antibody was from Promega Corp. (Madison, WI, USA). The primary antibody for FAS immunoblotting was a mouse IgG1 FAS monoclonal antibody (clone 23) from BD Biosciences Pharmingen (San Diego, CA, USA).
Cell cycle analysis
Adherent and detached cells were collected after trypsin detachment, washed in phosphate-buffered salt solution (PBS) and centrifugated at 1500 rpm. Cells were resuspended at 2 x106 cells/ml in PBS and fixed in ice-cold 80% ethanol for, at least, 24 h. Fixed cells were centrifugated at 300 x g and each sample resuspended in propidium iodide (PI) stain buffer (0.1% Triton X-100, 200 µg of DNase-free RNase A, 20 µg of PI) in PBS for 30 min. After staining, samples were analysed using a FACScalibur (Becton Dickinson; San Diego, CA, USA) and ModFiT LT (Verity Software).
Flow cytometric analysis of Her2/neu expression
Cells were seeded on 100-mm plates and cultured in complete growth medium. Upon reaching 75% confluence, the cells were washed twice with pre-warmed PBS and cultured in serum-free medium overnight. Orlistat was added to the culture as specified, and incubation was carried out at 37°C up to 48 h in low-serum (0.1% FBS). Then, the specific cell surface expression of Her2/neu-coded p185Her2/neu oncoprotein was determined by measuring the binding of a mouse anti-Her2/neu antibody directed against the extracellular domain of p185Her2/neu (clones Ab-5). Briefly, following treatments for 48 h, cells were washed once with cold PBS and harvested by scrapping in cold PBS. The cells were pelleted and resuspended in cold PBS containing 1% FBS and then incubated with 5 µg/ml Ab-5 antibody for 1 h at 4°C. After this, the cells were washed twice with cold PBS, resuspended in cold PBS containing 1% FBS, and then incubated with a fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgG secondary antibody (Jackson Immunoresearch Labs, West Grove, PA, USA) diluted 1:200 in cold PBS containing 1% FBS for 45 min at 4°C. Finally, the cells were washed once in cold PBS, and the flow cytometric analysis was performed with a FACScalibur flow cytometer (Becton Dickinson) equipped with Cell Quest Software (Becton Dickinson). The mean fluorescence signal associated with cells for labeled p185Her2/neu was quantified using the Geo Mean (GM) fluorescence parameter provided with the software. All observations were confirmed by at least three, independent experiments. The data are presented as means ± S.D.
Flow cytometric characterization of PARP cleavage
After being washed twice with PBS, cells were fixed in an ice-cold 1% solution of methanol-free formaldehyde in PBS for 15 min and postfixed in 80% ethanol for at least 2 h or stored at 20°C. Fixed cells were centrifugated at 300 x g for 3 min and ethanol was removed. The cells were then washed twice in PBS and suspended in 0.25% Triton X-100 in PBS for 10 min at room temperature to permeabilize plasma membrane. After centrifugation (300 x g, 5 min) the cell pellet was resuspended in 1% (w/v) solution of bovine serum album (BSA; Sigma-Chemicals, St. Louis, MO, USA) in PBS (PBS/BSA solution) for 10 min to suppress the non-specific component of the subsequent binding of antibody. The cells were centrifugated again (300 x g, 5 min) and the cell pellet (<106 cells) was suspended in 100 µl of PBS/BSA containing 1:200 diluted anti-PARP p89 antibody (rabbit polyclonal antibody; Cat. No. G7341, reported by the vendor to detect PARP-p89 fragment; Promega Corp., Madison, WI, USA). The cells were then incubated for 2 h at room temperature, washed twice with 1% PBS/BSA solution, resuspended in 100 µl of FITC-conjugated anti-rabbit IgG secondary antibody (Jackson Immunoresearch Labs, West Grove, PA, USA), and incubated for 30 min at room temperature (RT) in the dark. For subsequent analysis by flow cytometry cells were counterstained with 5 µg/ml of PI in the presence of 100 µg/ml of DNase-free RNase A in PBS.
Immunoblotting analyses of Her2/neu, PEA3 and FAS
Experimental cells were washed twice with PBS and then lysed in buffer [20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM ß-glycerolphosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, 1 mM phenylmethylsufonylfluoride] for 30 min on ice. The lysates were cleared by centrifugation in an Eppendorff tube (15 min at 14 000 x g, 4°C). Protein content was determined against a standardized control using the Pierce Protein kit (Rockford, IL, USA). Equal amounts of protein were resuspended in 5x Laemmli sample buffer for 10 min at 70°C, subjected to electrophoresis on either 3%8% NuPAGE Tris-Acetate (FAS, p185Her2/neu) or 10% SDS-PAGE (PEA3) and transferred to nitrocellulose membranes. Non-specific binding on the nitrocellulose filter paper was minimized by blocking for 1 h at room temperature (RT) with TBS-T [25 mM Tris-HCl, 150 mM NaCl (pH 7.5) and 0.05% Tween-20] containing 5% (w/v) non-fat dry milk. The treated filters were washed in TBS-T and then incubated with primary antibodies for 2 h at RT in TBS-T containing 5% (w/v) non-fat dry milk. The membranes were washed in TBS-T, horseradish peroxidase-conjugated secondary antibodies in TBS-T were added for 45 min, and immunoreactive bands were detected by enhanced chemiluminiscence reagent (Pierce, Rockford, IL, USA). Blots were re-probed with an antibody for ß-actin to control for protein loading and transfer. Densitometric values of protein bands were quantified using Scion Imaging Software (Scion Corp., Frederick, MD, USA).
In situ immunofluorescent staining
Cells were seeded at a density of 1 x 104 cells/well in a four-well chamber slide (Nalge Nunc International, Rochester, NY, USA). After 48 h incubation with orlistat, cells were washed with PBS, fixed in 4% paraformaldehyde in PBS for 10 min, permeabilized with 0.2% Triton X-100/PBS for 15 min, and stored overnight at 4°C with 10% horse serum in PBS. The cells were washed and then incubated for 2 h with anti-p185Her2/neu Ab-3 mouse monoclonal antibody diluted 1:200 in 0.05% Triton X-100/PBS. After extensive washes, the cells were incubated for 45 min with tetramethylrhodamine isothiocyanate (TRITC)-conjugated anti-mouse IgG secondary antibody (Jackson ImmunoResearch Labs) diluted 1:200 in 0.05% Triton X-100/PBS. The cells were washed five times with PBS and mounted with VECTASHIELD + DAPI (Vector Laboratories, Burlingame, CA, USA). As controls, cells were stained with primary or secondary antibody alone. Control experiments did not display significant fluorescence in any case (data not shown). Indirect immunofluorescence was recorded on a Zeiss microscope. Images were noise-filtered, corrected for background, and prepared using Adobe Photoshop.
Her2/neu promoter activity
Using FuGENE 6 transfection reagent (Roche Biochemicals, Indianapolis, IN) as directed by the manufacturer, overnight serum-starved cells seeded into 24-well plates (
5 x 104 cells/well) were transfected in low-serum (0.1% FBS) media with 300 ng/well of the pGL2-Luciferase (Promega, Madison, WI) construct containing a luciferase reporter gene driven by either an intact Her2/neu promoter fragment (Her2/neu wild-type PEA3-binding site-luciferase) or by a mutated Her2/neu mutated PEA3-binding site-luciferase along with 30 ng/well of the internal control plasmid pRL-CMV, which was used to correct for transfection efficiency. After 18 h, the transfected cells were washed and then incubated with either ethanol (v/v) or orlistat in 0.1% FBS. Alternatively, cells were transiently transfected with double-stranded siRNA targeting FAS gene (see below). Approximately 48 h after treatments, luciferase activity from cell extracts was detected with a Luciferase Assay System (Promega, Madison, WI, USA) using a Victor2TM 1420 Multilabel Counter (Perkin Elmer Life Sciences). The magnitude of activation in Her2/neu promoter-luciferase-transfected cells was determined after normalization of the luciferase activity in cells co-transfected with equivalent amounts of the empty pGL2-Luciferase vector lacking the Her2/neu promoter (Ø-luciferase) and the internal control plasmid pRL-CMV. This control value was used to calculate the relative change in the transcriptional activities of Her2/neu promoter-luciferase-transfected cells in response to treatments after normalization to pRL-CMV. The activity of the wild-type promoter in untreated control cells was defined as 100%.
RNA interference-mediated silencing of the FAS gene
Synthetic sense and antisense oligonucleotides targeting FAS gene were purchased from Dharmacon RNA Technologies (Lafayette, CO, USA). This double-stranded siRNA was as follows: sense sequence, CCCUGAGAUCCCAGCGCUGdTdT; antisense sequence, CAGCGCUGGGAUCUCAGGGdTdT. The design of these siRNA oligos targeting FAS gene was based on a DNA sequence of the type AA(N19) corresponding to the nucleotides 12101231 located 3' to the first nucleotide of the start codon of the human FAS cDNA (AACCCTGAGATCCCAGCGCTG). Searches of the human genome database (BLAST) were carried out to ensure the sequences would not target other gene transcripts. The final concentration of siRNA FAS in the 24-well plates was 200 nM. As a non-specific siRNA control, cells were transfected with equimolar concentrations (200 nM) of a non-specific control pool (siRNA negative control) containing four pooled non-specific siRNA duplexes (Upstate Cell Signaling Solutions-Dharmacon RNA Technologies; Catalong No. D-00120613).
Cell death ELISA
The induction of cell death was assessed using the Cell Death Detection ELISAPLUS Kit obtained from Roche Molecular Biochemicals USA (Indianapolis, IN, USA). This kit uses a photometric enzyme immunoassay that quantitatively determines the formation of cytoplasmic histone-associated DNA fragments (mono- and oligonucleosomes) after apoptotic cell death. Briefly, cells (7.5 x 103/well) were grown in 96-well plates and treated, in duplicates, with trastuzumab, orlistat or trastuzumab plus orlistat as specified. The induction of apoptotic cell death was evaluated using cytosolic fractions obtained from pooled adherent and floating cells (obtained by centrifugation at 200 x g for 10 min) by assessing the enrichment of nucleosomes in the cytoplasm using anti-histone biotin and anti-DNA peroxidase antibodies (RT for 2 h), and determined exactly as described in the manufacturer's protocol. After three washes, the peroxidase substrate was added to each well, and the plates were read at 405 nm at multiple time intervals. The enrichment of histone-DNA fragments in treated cells was expressed as a fold increase in absorbance compared with control (vehicle-treated) cells.
Cell viability
Cell viability was determined using a modified MTT reduction assay (Cell Tieter 96 Aqueous Non-Radioactive Cell Proliferation Assay, Promega Inc., Madison, WI, USA). Briefly, cells in exponential growth were harvested by trypsinization and seeded at a concentration of 3 x 103 cells/200 µl/well into 96-well plates, and allowed an overnight period for attachment. Then the medium was removed and fresh medium along with graded concentrations of orlistat in the absence or presence of trastuzumab was added to the cultures. Compounds were not renewed during the entire period of cell exposure. Following treatments (45 days), 96-well plates were centrifuged at 200 x g for 10 min and MTS/PMS solutions was added to each well at 1/5 volume. After incubation for 3 h at 37°C in the dark, absorbances were measured at 490 nm using a multiwell plate reader. Control cells without agents were cultured using the same conditions with comparable media changes. Compounds were not renewed during the entire period of cell exposure. The cell viability effects from exposure of cells to each compound were analysed, generating concentrationeffect curves as a plot of the fraction of unaffected (surviving) cells versus drug concentration. Doseresponse curves were plotted as percentages of the control cell absorbances, which were obtained from control cells treated with appropriate concentrations of the compounds vehicles that were processed simultaneously. For each treatment, cell viability was evaluated as a percentage using the following equation:
![]() |
Synergy studies: median-effect (ChouTalalay) analyses
Synergism, addition or antagonism for orlistat and trastuzumab was determined by the multiple drug analysis of Chou and Talalay, which is based on the median-effect principle. Details of this methodology have been published [35
37
]. Briefly, this method involves plotting doseeffect curves for each agent and for multiply diluted, fixed ratio combinations of agents using the median-effect equation:
![]() |
In this equation, D is dose, Dm is the dose required for 50% effect (e.g. 50% inhibition of cell viability, IC50), fa is the fraction affected by dose D (e.g. 0.9 if cell viability is decreased by 90%), fu is the unaffected fraction (therefore,
), and m is a coefficient of sigmoidicity of the doseeffect curve; m = 1, >1 and <1 indicate hyperbolic, sigmoidal and negative sigmoidal doseeffect curves, respectively, for an inhibitory drug. Equation (1) may be rearranged as follows:
![]() |
The parameters m and Dm are easily determined by the median-effect plot
versus
which is based on the logarithmic form of equation (1) and yields a straight line where m is the slope and (Dm) is the x intercept. IC50 values (by interpolation) and Dm values (by the median-effect plot) were usually similar. Equation (1) may thus be solved, providing the issoeffective dose (Dx) for any effect level (e.g. IC10 for fa=0.1; IC30 for fa=0.3; IC50 for fa=0.5, and so on). For each level of cell growth inhibition, a parameter called the Combination Index (CI) was calculated according to the equation:
![]() |
is 0 (i.e. CI is the sum of two terms); if the agents are mutually non-exclusive (e.g. independent mode of action),
is 1 (i.e. CI is the sum of two terms). If it is uncertain whether the agents act in a similar or an independent manner, the formula may be solved both ways. For simplicity, however, the third term of the Chou and Talalay equation is usually omitted and, thus, the mutually exclusive assumption (or classic isobologram) is indicated. Only the CI values obtained from the classic (mutually exclusive) calculation are therefore given in the Results section. Similar results were obtained when the complete equation was used for combination studies with trastuzumab and orlistat (data not shown). Different values of CI may be obtained by solving the equation (3) for different values of fa (e.g. different degrees of cell toxicity). In this method, CI values <1 indicate synergy (the smaller the value, the greater the degree of synergy), values >1 indicate antagonism and values equal to 1 indicate additive effects. In our current studies, CI profiles were compared to a preset null interval of 0.951.05 (addition), so that mean CI values >1.05 or <0.95 were interpreted as being suggestive of antagonism and synergism, respectively. Each experiment was carried out with triplicate cultures for each data and was repeated independently at least three times. The conformity of the experimental data to the median-effect principle of the mass-action law was automatically provided by the computer printout in terms of the linear correlation coefficient (r-value) of the median-effect plots. In our studies, the r-values for orlistat, trastuzumab and their combinations were all >0.95.
Statistical analysis
All observations were confirmed by at least three independent experiments. The data are presented as means ± SD. The Student's t-test (paired and unpaired) was used to evaluate the statistical significance of mean values. Statistical significance levels were P <0.05 and P <0.005. All P values are two-tailed.
| Results |
|---|
|
|
|---|
Tetrahydrolipstatin, which is also known as orlistat and is marketed as XenicalTM, is a derivative of a natural product containing a ß-lactone moiety (Figure 1A). The ß-lactone can undergo nucleophilic attack on the carbonyl carbon of the lactone ring by the active site serine of the esterase in the pancreatic lipase, yielding a covalent adduct between enzyme and inhibitor [2
|
Orlistat induces blockade of cell cycle progression
To determine the effects of orlistat on breast cancer cell-cycle progression, SK-Br3 cells, after an overnight starvation period in media without serum, were exposed to a saturating concentration of orlistat (40 µM) in low-serum (0.1% FBS) conditions. The distribution of cells in different phases of the cell cycle was assessed at 6, 24, 48 and 72 h using flow cytometry. The time-dependent response of SK-Br3 breast cancer cells to orlistat was characterized by a loss of the G2-M population, as well as an accumulation of cells in the S-phase of cell cycle. Importantly, orlistat exposure substantially promoted apoptosis as evidenced by a time-dependent accumulation of sub-G1 populations that has <2N DNA and represents dead cells (Figure 2A).
|
A more detailed analysis of cell-cycle distribution was performed in SK-Br3 cells incubated for 72 h with increasing concentrations of orlistat (020 µM) using the ModFiT LT software (Figure 2B, ). Orlistat-induced inhibition of FAS activity produced, in a dose-dependent manner, a dramatic reduction in the proportion of G2-M cells (from 10% in untreated control cells to 2.5% in the presence of 20 µM orlistat), while it significantly increased the proportion of S-phase cells by five-fold (from 11% in untreated control cells to 53% in the presence of 20 µM orlistat). Moreover, a dramatic dose-dependent increase in sub-G1 (apoptotic) cells was observed following exposure to increasing concentrations of orlistat (up to 54% compared with 3% in untreated control cells).
Most of the fatty acids produced by tumor cells are incorporated into membrane phospholipids, and phospholipid synthesis is inhibited when fatty acid synthesis is inhibited [47
, 48
]. Phospholipid biosynthesis is greatest during the G1 and S phases, with doubling of the membrane mass occurring during S phase in preparation for cell division [49
]. Indeed, most of the phospholipid accumulation in preparation for mitosis takes place during the S phase [49
]. Our current results demonstrating the ability of orlistat to arrest the cell cycle at the G1-S transition in breast cancer cells strongly indicates that orlistat and other orlistat-related ß-lactones, through its ability to disrupt the endogenous fatty acid metabolism, should be considered to be a promising class of novel chemotherapeutics that could be exploited for anti-breast cancer therapy.
Orlistat promotes apoptotic cell death of SK-Br3 breast cancer cells
Poly(ADP-ribose) polymerase (PARP), a nuclear enzyme involved in DNA repair and activated in response to DNA-damage, is an early target of caspases during apoptosis [50
52
]. The specific cleavage of this protein by caspase-3 onto 89- and 24 kDa fragments is considered to be a hallmark of the apoptotic mode of cell death [50
53
]. Here, PARP cleavage was detected immunocytochemically using an antibody that recognizes its 89-kDA fragment (PARP p89). The frequency and extent of PARP cleavage in its cell-cycle position was measured by multiparameter flow cytometry [54
]. Figure 2D presents bivariate distributions (scatter-plots) representing immunufluorescence of PARP p89 versus DNA content of SK-Br3 cells treated with 20 µM orlistat for 72 h. Although cells from all phases of the cycle showed evidence of increased PARP cleavage in orlistat-treated cells, it was quite evident that PARP cleavage was more selective to cells progressing to the G1 phase. Thus, this analysis revealed that the percentage of G1 phase cells exhibiting PARP cleavage was about six-fold higher compared with G1-associated PARP cleavage in the untreated population. These findings, together with the above results demonstrating a decline in the G1 population of orlistat-treated cells, reveal that orlistat-induced FAS blockade does not promote arrest in G0-G1 as breast cancer cells are prompted to apoptosis as revealed by the degradation of PARP.
Orlistat down-regulates p185Her2/neu expression
Since we previously demonstrated that chemical FAS inhibitors cerulenin and C75 strongly repressed Her2/neu oncogene overexpression in cancer cells [33
], we here evaluated whether orlistat-induced FAS blockade similarly promoted down-regulation of Her2/neu expression in SK-Br3 breast cancer cells. Flow cytometric analyses using a monoclonal antibody directed against the extracellular domain of Her2/neu (Ab-5; Figure 3A) established the ability of orlistat to dramatically decrease the expression levels of cell surface-associated Her2/neu in SK-Br3 (up to 90% reduction; Figure 3B).
|
Although p185Her2/neu is a transmembrane oncoprotein, its cytoplasmic domain can also function as a nuclear transcriptional activator [55
Orlistat inhibits Her2/neu promoter activity through the Ets transcription factor PEA3
To characterize the specific mechanism through which orlistat-induced inhibition of FAS activity molecularly modulated Her2/neu oncogene expression, we performed transient transfection experiments with a luciferase reporter gene driven by the Her2/neu promoter (pNulit). Remarkably, orlistat treatment was found to profoundly repress the activity of Her2/neu gene promoter (up to 60% inhibition) in SK-Br3 breast cancer cells (Figure 3E, left panel). We sought an independent means of inhibiting FAS to solidify the role of this enzyme in regulating Her2/neu promoter activity. Therefore, we compared orlistat and siRNA-targeting FAS for the ability to knock down the transcriptional activation of Her2/neu gene in SK-Br3 breast cancer cells. RNAi-mediated silencing of FAS reduced the level of FAS protein [33
] and likewise down-regulated Her2/neu promoter activity by about 50% (Figure 3E, left panel). Together, these findings provide strong support for the idea that a FAS blockade in breast cancer cells acts upon Her2/neu oncogene expression, at least in part, via regulation of Her2/neu promoter activity.
To gain additional insight into the molecular mechanisms underlying the repression of Her2/neu promoter activity induced by orlistat, we examined the expression of Her2/neu regulator PEA3 following orlistat-induced blockade of FAS activity in SK-Br3 cells. The DNA-binding protein PEA3, a member of the Ets transcription factor family, specifically targets a DNA sequence on the Her2/neu promoter and down-regulates its promoter activity thus suppressing Her2/neu overexpression and inhibiting tumorigenesis [52
, 58
]. Interestingly, a significant accumulation of the DNA-binding protein PEA3 was observed following orlistat exposure (Figure 3D). Moreover, when orlistat's effects on the transcriptional activation of Her2/neu gene were characterized on a Her2/neu promoter bearing a mutated PEA3 binding sequence (5'-AGGAAG-3' to 5'-AGCTCG-3'), the luciferase reporter gene driven by the PEA3 site-mutated sequence was not subject to negative regulation by either orlistat or siRNA FAS (Figure 3E, right panel). As previously demonstrated by Xing et al. in SKOV-3 and MDA-MB-453 cells [57
], when the levels of wild-type and mutant Her2/neu promoter activities were compared in untreated control cells, the mutant promoter was significantly less active than the wild-type in SK-Br3 cells. These results, altogether, strongly suggest that orlistat, through its FAS target, represses Her2/neu promoter activity through a positive regulatory PEA3-binding DNA motif. Equivalent results were found in Her2/neu-overexpressing BT-474 breast cancer cells (data not shown).
Orlistat co-exposure synergistically enhances trastuzumab efficacy in Her2/neu-overexpressing breast cancer cells
We explored whether the down-regulatory effects of orlistat on Her2/neu gene expression could modulate the growth inhibitory effects of trastuzumab (HerceptinTM), a humanized monoclonal antibody binding with high affinity to the ectodomain of p185Her2/neu oncoprotein and showing encouraging therapeutic effects in patients with Her2/neu-overexpressing metastatic breast cancer [59
62
]. Although there remains controversy over which method is best for detecting true in vitro synergy between drug combinations, the combined cytotoxic effect of orlistat and trastuzumab was assessed using the median-effect plot analysis of Chou and Talalay [35
37
]. This procedure allows the characterization of drug interactions with a single number, the Combination Index (CI). The CI parameter indicates whether the doses of the two agents required to produce a given degree of cytotoxicity are greater than (CI >1 or antagonism) equal to (CI = 1 or addition) or less than (CI <1 or synergism) the doses that would be required if the two agents were strictly additive. For this type of analysis and for each drug separately (i.e. orlistat and trastuzumab), we measured how the fraction affected (i.e. the fractional cell toxicity) varied with differing doses. For two drugs in combination (i.e. orlistat + trastuzumab, orlistat
trastuzumab or trastuzumab
orlistat) we varied the doses of the two agents while monitoring the fraction affected; however, the doses were varied such that a constant ratio of agent 1 (orlistat) to agent 2 (trastuzumab) was maintained. Specifically, 1.5, 2.0- and 3.0-fold serial dilutions of orlistat and trastuzumab were prepared and combined with each other from the lowest to the highest concentration while assessing the cell fraction affected. The combination ratio was designed to approximate the IC50 ratio of the drugs determined in preliminary experiments, so that the contribution of the effect for orlistat and trastuzumab in the mixture would be the same (i.e. equipotency ratio). Figure 4A shows the CI plots at various effect levels (fraction affected) for the combination of orlistat and trastuzumab in SK-Br3 cells using different schedules of administration. The synergy observed with concurrent orlistat and trastuzumab exposure for 96 h was apparent at all the levels of cell kill (10%, 30%, 50%, 70% and 90%), with CI values ranging from 0.110 (strong synergism) to 0.847 (moderate synergism). Although the CI values obtained in SK-Br3 cells exposed for 48 h to orlistat before exposure to trastuzumab for 48 h also suggested a synergistic effect under this sequential schedule (CI = 0.380 at the IC10, CI = 0.514 at the IC30), this regimen became additive and slightly antagonist at levels exceeding the 50% cell kill boundary (CI = 1.210 at the IC90). These findings suggest that co-exposure of Her2/neu-overexpressing SK-Br3 cells to FAS inhibitor orlistat and anti-Her2/neu antibody trastruzumab is necessary for maximal augmentation of cytotoxicity, whereas sequential administration of trastuzumab followed by orlistat significantly reduces the synergism between the two agents.
|
To determine whether the synergy between orlistat and trastuzumab was accompanied with an increase in the extent of apoptosis, SK-Br3 cells were exposed to trastuzumab in the absence or presence of increasing concentrations of orlistat, cell death was measured by an ELISA that detected DNA-histone fragmentation, and the x-fold increase in apoptotis-related cell death was calculated by comparing the ELISA optical density reading of treated samples with the values of untreated cells as 1.0. SK-Br3 cells co-treated with trastuzumab and orlistat exhibited a higher degree of cell death compared with that observed when trastuzumab and orlistat were used as single agents (Figure 4B). Therefore, the increased sensitivity to trastuzumab seen in orlistat-treated SK-Br3 cells is not simply the result of changes in cell proliferation, but might actually be due to increases in apoptotic cell death following orlistat-induced cell damage.
High levels of FAS determine breast cancer cell hypersensitivity to orlistat
We finally characterized the relationship between the cytotoxic effects of orlistat and the expression of FAS in a panel of human breast cancer cell lines. Cells were seeded in microtiter plates and then cultured in the absence or presence of increasing concentrations of orlistat until untreated cells reached confluence. Then, the metabolic status of breast cancer cells was judged by the mitochondrial conversion of the tetrazolium salt, MTT, to its formazan product (MTT assay). Concentrationeffect curves were generated by plotting the fraction of unaffected (surviving) cells versus orlistat concentration, and IC50 values (the doses of orlistat producing a 50% reduction in cell viability) were calculated as described in Material and methods. Breast cancer cell lines exhibiting IC50 values >20 µM for orlistat were arbitrarily defined as low-sensitive, whereas those exhibiting IC50 values <5 µM were defined as high-sensitive (Figure 5A, bottom panel). When the status of FAS expression (as assessed by western blotting using a monoclonal antibody against FAS (Figure 5A, top panel) was correlated to the sensitivity profile of breast cancer cells to orlistat-induced cytotoxicity, we found that Her2/neu- and FAS-overexpressing SK-Br3 and BT-474 cells were significantly more sensitive to orlistat than others, with IC50s of 7.5 ± 3 and 10 ± 1 µM, respectively. Moderately FAS-expressing MDA-MB-453 and T47D cells, which exhibit high and moderate levels of Her2/neu, respectively, demonstrated an intermediate profile of sensitivity to orlistat, with IC50s of 13 ± 2 and 12 ± 2 µM. Her2/neu-negative and low-FAS-expressing MDA-MB-435 and MDA-MB-231 exhibited the highest IC50 values for orlistat (23 ± 3 and 21.5 ± 4 µM, respectively). This analysis clearly established that the cytotoxic effects of orlistat correlate, indeed, with constitutive FAS expression levels in breast cancer cells.
|
To conclusively confirm the selectivity of orlistat toward FAS and Her2/neu overexpressors, we analyzed the cytotoxic effects of orlistat following the forced expression of Her2/neu oncogene in MCF-7 breast cancer cells, which naturally express moderate levels of both FAS and Her2/neu [29
| Discussion |
|---|
|
|
|---|
The lipogenic enzyme FAS, also called oncogenic antigen-519, is selectively and highly expressed in virulent breast cancers [8
Our study confirms that micromolar concentrations of orlistat, a drug approved for treating obesity and recently characterized as a potent and selective inhibitor of FAS in prostate carcinoma cells [3
], induce potent anti-proliferative and apoptotic effects in breast cancer cells through its ability to block the lipogenic activity of FAS. These results not only reinforce the notion that breast cancer-associated FAS activity is a relevant molecular target for drug development in oncology, but further demonstrate a close involvement of Her2/neu (erbB-2) oncogene, the overexpression and/or activation of which is known to play an important role in the etiology, aggressive progression and poor clinical outcome of breast carcinomas. Thus, when we characterized signaling molecules participating in the cellular events that followed orlistat-induced inhibition of FAS activity and preceded inhibition of breast cancer cell proliferation, orlistat treatment was found to dramatically suppress Her2/neu expression in SK-Br3 and BT-474 cell lines, two in vitro models of FAS and Her2/neu-overexpressing breast cancer [29
]. This observation supports our prior work in which pharmacological and RNAi-mediated blockade of FAS signaling was found to suppress Her2/neu overexpression in cancer cells [33
]. Indeed, the ability of orlistat to deplete Her2/neu oncoprotein in breast cancer cells constitutes an independent strategy to confirm that FAS inhibition, regardless of the mechanism of action of the chemical FAS blocker, is accompanied by the specific suppression of Her2/neu oncogene. These findings strongly support the idea that breast cancer-associated FAS is not a mere manifestation of early and common cancer-associated epigenetic changes but rather actively contributes to the breast cancer phenotype by regulating the expression, activity and cellular localization of Her2/neu oncogene [16
, 33
, 34
].
The present study also provides new insight into the mechanisms underlying the connection between breast cancer-associated FAS and Her2/neu oncogene. Unlike the humanized anti-Her2/neu monoclonal antibody trastuzumab (HerceptinTM), which targets the ectodomain of Her2/neu receptor and promote its degradation, FAS blockade appears to mitigate Her2/neu overexpression, at least in part, via PEA3 binding to the Her2/neu promoter, thus suppressing its transcriptional activity. Therefore, this distinct mechanism of action should not be affected by the mechanisms of resistance described for trastuzumab-based anti-Her2/neu immunotherapy [70
73
]. Moreover, orlistat-induced inhibition of FAS activity significantly enhanced the anti-proliferative effects of trastuzumab. To evaluate the nature of the interaction following three different schedules of administration (orlistat + trastuzumab, orlistat
trastuzumab and trastuzumab
orlistat), which might be synergistic, additive or antagonistic, we used the Chou and Talalay analysis, a mathematical method employed for assessing the combined effect of antitumor drugs in vitro as a preclinical screening test [35
37
]. Our studies demonstrated that the greatest number of synergistic combinations as well as the greatest magnitude of synergy was observed when Her2/neu- and FAS-overexpressing SK-Br3 breast cancer cells were exposed to the two agents simultaneously, whereas additive or even antagonistic interactions were observed when either FAS blocker orlistat preceded trastuzumab or trastuzumab preceded orlistat, respectively. Indeed, orlistat-induced transcriptional repression of Her2/neu gene, when concurrently combined with sub-optimal concentrations of trastuzumab, was able to promote high levels of apoptotic cell death in Her2/neu-overexpressing breast cancer models. From a clinical perspective, these findings suggest that the simultaneous administration of orlistat-related anti-FAS compounds and trastuzumab may be the optimal schedule for the combination in terms of cytotoxic effects. Although the ultimate molecular mechanisms of interaction operating with these schedules were not conclusively addressed by our experiments, these events may be related to the relative output of Her2/neu-driven signaling in breast cancer cells. We recently demonstrated that the synergistic inhibition of breast cancer cell viability following the concomitant targeting of Her2/neu and FAS using sub-optimal doses of trastuzumab and chemical FAS blockers cerulenin and C75 was accompanied by a dramatic reduction on Her2/neu expression levels [33
]. This strongly suggests a novel role of Her2/neu as a key molecular sensor of the energy imbalance that follows perturbation of cancer-associated endogenous fatty acid metabolism. Our current approach further demonstrates that the simultaneous combination of a FAS inhibitor, such as orlistat and trastuzumab, is more effective than the single treatments in inducing cytotoxicity and apoptotic cell death toward Her2/neu-overexpressing breast cancer cells. These findings support the clinical potential of concurrent treatments using FAS blockers, which seem to repress Her2/neu oncogene expression at the transcriptional levels by up-regulating PEA3, and monoclonal antibodies to Her2/neu such as trastuzumab, which targets the ectodomain of p185Her2/neu and promotes Her2/neu protein degradation [74
76
]. Pre-exposure to orlistat does not affect FAS expression [3
], while significantly down-regulating Her2/neu expression. This, in turn, may raise the sensitivity threshold for trastuzumab-induced cell growth inhibition, then contributing to the observed reduction of synergism under a sequential schedule orlistat
trastuzumab. Pre-exposure to trastuzumab not only reduces p185Her2/neu but further down-regulates FAS [30
, 31
]. Under these conditions, trastuzumab pretreatment not only decreases the levels of orlistat's target (i.e. FAS) but further blocks one of the molecular mechanisms through which FAS blockade promotes breast cancer cell toxicity (i.e. Her2/neu down-regulation). Accordingly, the trastuzumab
orlistat schedule yields the highest CI (i.e. antagonistic) values in all the combinations tested for orlistat and trastuzumab. Nonetheless, considering that preclinical studies clearly indicate that transcriptional repressors that down-regulate Her2/neu promoter activity can be effective regimens for cancer treatment [77
], if chemically stable FAS inhibitors or cancer cell-selective vector systems able to deliver RNAi targeting FAS gene demonstrates systemic anticancer effects in vivo, our results render FAS as a promising therapeutic target to influence the outcome of Her2/neu-overexpressing breast carcinomas.
Recent experimental and epidemiological data strongly suggested a protective effect of statins on cancer and further support a role of statins in chemoprevention and, perhaps, treatment of cancer disease [78
81
]. The molecular mechanisms underlying the anticancer activity of different statins, however, remain largely uncertain. The ability of statins such as simvastatin to block the enzymatic activity of 3-hydroxy-3-methylglutaryl-coenzyme A reductase, might prevent the expression of the oncogenic phenotype by blocking the activation of oncoproteins such as k-Ras [78
81
]. This mechanism of action, however, should not affect the transcription of oncogenes and, therefore, precludes the potential of simvastatin-related statins to affect the malignant phenotype. However, orlistat actively regulates the malignant phenotype of breast cancer cells as it suppresses Her2/neu oncogene expression by blocking the lipogenic activity of FAS. Though orlistat possess extremely low oral bioavailability, it is obvious that a novel formulation and/or route of administration will be required for treating tumors such breast carcinomas. In its approved formulation orlistat is administered orally, which could be useful in treating tumors of the gastrointestinal (GI) tract. Interestingly, we have recently found orlistat to block Her2/neu overexpression and induce apoptosis in the highly-metastatic NCI-N87 stomach carcinoma cell line [82
], thus suggesting that this selective lipase inhibitor used for treating obesity may represent a suitable drug candidate for treating Her2/neu-overexpressing GI carcinomas through its ability to block cancer-associated FAS hyperactivity. Moreover, future analyses of the incidence and clinical outcome of gastrointestinal carcinomas in a representative obese population earlier receiving orlistat treatment, may illustrate further its chemopreventive effects to GI cancers. Nevertheless, its potent pro-apoptotic activity, which is accompanied by a dramatic down-regulation of Her2/neu oncogene, and the synergistic interaction that occurs following co-treatment with orlistat and trastuzumab, cannot exclude the notion that more potent or bioavailable variants of orlistat and/or orlistat-related ß-lactones as suitable drug candidates for treating Her2/neu-overexpressing breast carcinomas.
| Acknowledgements |
|---|
The authors wish to thank Mien-Chie Hung (The University of Texas M.D. Anderson Cancer Center, Department of Cancer Biology, Section of Molecular Cell Biology, Houston, Texas, USA) for kindly providing Her2/neu promoter constructs. Javier A. Menendez is the recipient of a Translational Research Pilot Project (PP2) and of a Career Development Award from the Specialized Program of Research Excellence (SPORE) in Breast Cancer (Robert H. Lurie Comprehensive Cancer Center, Chicago, USA), of a Basic, Clinical and Translational Award (BRCTR0403141) from the Susan G. Komen Breast Cancer Foundation (USA), and of a Breast Cancer Concept Award (BC033538 [GenBank] ) from the Department of Defense (DOD, USA).
Received for publication December 26, 2004. Accepted for publication March 6, 2005.
| References |
|---|
|
|
|---|
1. McNeely W, Benfield P. Orlistat. Drugs 1998; 56: 241249.[CrossRef][ISI][Medline]
2. Hadvary P, Sidler W, Meister W et al. The lipase inhibitor tetrahydrolipstatin binds covalently to the putative active site serine of pancreatic lipase. J Biol Chem 1991; 266: 20212027.








