Annals of Oncology Advance Access originally published online on April 13, 2005
Annals of Oncology 2005 16(6):934-941; doi:10.1093/annonc/mdi189
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2005 European Society for Medical Oncology
Analysis of the dinucleotide repeat polymorphism in the epidermal growth factor receptor (EGFR) gene in head and neck cancer patients
1 Laboratoire d'Oncopharmacologie, Centre Antoine Lacassagne, Nice; 2 INSERM U491, Faculté de Médecine de la Timone, Marseille, France; 3 Service de Radiothérapie, Institut Jules Bordet, Bruxelles, Belgique; 4 Service de Médecine Nucléaire, Centre Antoine Lacassagne; 5 Service ORL, Centre Antoine Lacassagne; 6 Service ORL du CHU de Nice; 7 Service de radiothérapie, Centre Antoine Lacassagne, Nice, France
* Correspondence to: Dr G. Milano, Oncopharmacology Unit, Centre Antoine Lacassagne, 33 avenue de Valombrose, 06189 Nice Cedex 2, France. Tel: +33-4-92-03-15-53; Fax: +33-4-93-81-71-31; Email: gerard.milano{at}nice.fnclcc.fr
| Abstract |
|---|
|
|
|---|
Background:: Epidermal growth factor receptor (EGFR) overexpression is associated with poor prognosis in head and neck cancer. The first intron of EGFR gene is polymorphic (923 CA repeats) and transcription declines when the number of repeats increases.
Patients and methods:: EGFR polymorphism (fluorescent genotyping) and expression (ligand-binding assay) were analyzed in tumors and normal tissues from 112 patients (100 men, 12 women; mean age 60 years).
Results:: The number of CA repeats varied from 15 to 22. Allelic distribution was trimodal (predominance of 16, 20 and 18 CA repeats). EGFR concentrations were significantly higher (P=0.02) in homozygous tumors as compared with heterozygous. Considering homozygous tumors, or classifying genotypes as short/long/intermediary (two alleles <17 versus two alleles
17 versus others), no relationship was observed between tumoral EGFR genotype and expression. In the 76 tumors exhibiting at least one 16-CA allele, the length of the remaining allele was inversely correlated to EGFR expression (P=0.047). Tumoral EGFR expression, performance status (WHO criteria) and node involvement were independent predictors of specific survival (P <0.01). Tumoral or normal tissue EGFR genotype did not influence survival.
Conclusions:: Intron 1 EGFR polymorphism may be implicated in the regulation of EGFR expression in head and neck tumors.
Key words: epidermal growth factor receptor, gene polymorphism, head and neck cancer, prognostic markers
| Introduction |
|---|
|
|
|---|
Epidermal growth factor receptor (EGFR) is a protein tyrosine kinase which plays a crucial role in signal transduction pathways that regulate key cellular functions like survival and proliferation. The transduction of extracellular signals to the cytoplasm via EGFR depends not only on ligand binding to the extracellular domain, but also on the concentration of EGFR on the cell surface. We and others [1
Among the recent advances in molecular targeted therapy of cancer, anti-EGFR therapeutic approaches are currently the most promising and the most advanced at the clinical level [4
9
]. They include the use of monoclonal antibodies and small tyrosine kinase inhibitors. Anti-EGFR therapies have been applied with promising results in lung cancer and head and neck cancer [10
, 11
]. A recent report indicates major objective responses in platinum-refractory advanced head and neck cancer patients treated with cetuximab, an IgG1 monoclonal antibody that binds selectively to EGFR [12
]. A real benefit could thus be anticipated with anti-EGFR drugs, alone or in combination, for a better management of head and neck cancer patients.
As recently highlighted by Ellis and Hoff [13
], the search to identify reliable sensitivity markers for targeted therapies has led to rather disappointing results. A very promising exception is the recent description, in lung tumor samples, of EGFR somatic mutations associated with clinical responsiveness to the EGFR tyrosine kinase inhibitor, gefitinib (Iressa) [14
]. In addition, experimental studies have demonstrated a positive correlation between the level of tumoral EGFR expression and sensitivity to Iressa [15
]. However, clinical data on tumoral EGFR expression for predicting response to anti-EGFR therapies are rather inconclusive. Interestingly, clinical observations reveal that efficacy of anti-EGFR treatment is associated with the intensity of skin rash, which is one of the major side-effects of EGFR-targeting drugs [10
, 16
]. One explanation for this observation could involve pharmacokinetic effects, with responsive patients exhibiting highest drug concentrations in both normal and tumoral tissues relative to non-responsive patients, thus leading to greater pharmacodynamic effects. Another possible explanation could be based on pharmacogenetics, with response rates linked to germinal EGFR gene polymorphism.
The first intron of the EGFR gene has an important regulatory function [17
]. This intron contains a highly polymorphic microsatellite sequence [923 CA simple sequence repeat (SSR)] close to a downstream enhancer sequence. Even though it is located more than 1000 bp downstream of the promoter, helical conformation analyses have suggested a possible regulatory role of this polymorphic region on transcription. In fact, it has been proposed that the number of CA repeats may be able to modify DNA conformation after binding of transcription factors [18
]. Accordingly, experimental data have demonstrated that transcription activity declines when the number of repeats increases [19
]. Moreover, clinical data on breast cancer tumors have suggested that the longer the CA repeat (by considering the shorter CA repeat allele), the lower the EGFR expression [20
]. Also, tumors with loss of heterozygocity in intron 1 expressed lower EGFR expression when the shorter allele was lost, compared with loss of the longer one [20
]. Interesting preliminary in vitro and clinical data on the influence of the CA repeat polymorphism on the efficacy of EGFR tyrosine kinase inhibitors were reported by Perea et al. [21
]. Results on 13 cell lines demonstrated that the cell lines with short CA repeats (sum of alleles <36) exhibited the highest EGFR mRNA and protein expression, and were significantly more susceptible to erlotinib (Tarceva) than the remaining cell lines with long CA repeats [21
]. Also, analysis of EGFR genotype in skin biopsies from 19 patients treated by gefitinib (Iressa) showed that patients with short CA repeats had a higher frequency of rash relative to patients with long CA repeats (61% versus 17%) [21
].
Clinical data on EGFR dinucleotide repeat polymorphism have not been reported so far in head and neck cancer. On account of the strong prognostic value of EGFR expression, as well as the probable increasing use of anti-EGFR therapies in head and neck cancer patients, we determined EGFR CA-SSR polymorphism along with EGFR expression in tumoral and normal tissue biopsies from a consecutive group of 112 head and neck cancer patients. The aim of the present study was to analyze EGFR genotypephenotype relationships, as well as their respective prognostic values.
| Patients and methods |
|---|
|
|
|---|
Patients
This retrospective study was conducted on 112 consecutive head and neck cancer patients treated in our Institute between January 1993 and January 1996 (100 men, 12 women; mean age 60 years, range 4087). Ethnic origin, initial performance status (WHO criteria), tumor localizations, tumor staging, histologic differentiation, initial treatments, sites of recurrence and treatment of recurrence are detailed on Table 1. Thirty-two patients had surgery and 77 had an organ preservation treatment (induction chemotherapy followed by surgery for the majority). Induction chemotherapy consisted of cisplatin (100 mg/m2 intravenously on day 1) followed by 5-fluorouracil (5-FU) (1 g/m2/day, continuous infusion, days 26), or 5-FU + folinic acid (500 mg/m2/day 5-FU + 200 mg/m2/day pure l folinic acid, continuous infusion, days 26); three to four cycles were administered at 3-week intervals. When administered alone or after induction chemotherapy, radiotherapy was given 5 days a week over 7 weeks using 60Cobalt or linear accelerator photons (46 MV). A standard fractionation (2 Gy/day) was applied to the tumor, for a total dose of 65 Gy. Irradiation of the supraclavicular nodal regions was performed using an anterior supraclavicular field (50 Gy). Concomitant chemoradiotherapy consisted of three cisplatin-5-FU courses at 3-week intervals (with a 5-FU dose reduced to 750 mg/m2/day), associated with continuous radiotherapy given as two daily fractions of 1.2 Gy on primary tumor and satellite nodes (5 days per week for 7 weeks) using 60Cobalt or linear accelerator photons, as described above. Total dose was 80.4 Gy on the oropharynx or 75.6 Gy on the hypopharynx.
|
After initial treatment, 46 patients developed progressive disease. Duration of survival was calculated from the date of initial diagnosis. For specific survival, the end point was cancer-related death. At time of analysis, 81 patients had died (53 from cancer-related death, one from chemotherapy-related death, 20 from independent causes and seven from unknown causes). Three patients who rapidly lost to follow-up were not considered in survival analyses. Median follow-up was 28 months for the whole population (n=109) and 100 months for living patients (n=28).
Tissue handling
For all patients, tumoral biopsies (3070 mg) were taken at time of initial diagnosis (before any treatment). In addition, at the same time a normal tissue biopsy was taken in the oral cavity, at distance from the tumor (opposite area), for 91 patients (3040 mg). Samples were immediately stored in liquid nitrogen until assayed. As previously described [9
], biopsies were then homogenized in TrisHCl buffer and differential centrigurations allowed the separation of crude membranes from the cytosol. EGFR expression levels were analyzed on the membrane preparation and EGFR genotype was analyzed on genomic DNA extracted with phenol-chloroform.
EGFR phenotyping
EGFR concentrations in tumor and normal tissues were analyzed by a ligand-binding assay based on competition between [125I]EGF and unlabeled EGF (both human recombinant), as described previously [3
]. The limit of sensitivity was 1 fmol/mg protein and interday reproducibility was 12% (membrane preparation from a human placenta as control). Membrane proteins were quantified according to the Bradford method, using human serum albumin as standard.
EGFR genotyping
To increase the reliability of the genotyping data, two different fragments, each containing the microsatellite CA repeat situated within intron 1 of the EGFR gene, were amplified by PCR with one dye-labeled sense primer and one of two different antisense unlabeled primers. Two fluorochrome-labeled PCR products were thus obtained for each DNA to be genotyped: one small-size product (214228 bp) and one large-size product (264278 bp). The primers used were: EGFR sense (EGFR-s primer) D3-GTTTGAAGAATTTGAGCCAACC, nt 10 62610 647 (GenBank AF288738
[GenBank]
); EGFR small-size antisense (EGFR-as) GCTCAAGGTTGGAATTGTGC, nt 10 82210 841; EGFR large-size antisense (EGFR-al) AGCCAATGACATCAACAGCA, nt 10 87210 891. Genomic DNA (80 ng) was submitted to 35 PCR cycles, with an annealing step of 30 s at 60 °C for the small fragment or 30 s at 55 °C for the large fragment, giving PCR products between 214 bp (corresponding to 15 CA repeats) and 228 bp (22 CA repeats), or between 264 bp (15 CA repeats) and 278 bp (22 CA repeats), respectively. These products were pooled and analyzed in a single run on a CEQ-8000 Beckman-Coulter sequencer with fragment separation performed by capillary electrophoresis with a high-resolution linear polyacrylamide gel. Identification of fragment sizes, based on internal size standards, and fluorescence quantitation were performed using the appropriate Beckman software.
Statistics
The influence of EGFR genotype on EGFR expression was tested by means of non-parametric tests (MannWhitney, KruskalWallis or Spearman correlation depending on the classification of EGFR genotypes). The above analyses were performed in 111 tumoral samples and 72 normal tissue samples (i.e. in samples analyzed both for EGFR expression and genotype). Specific survival (cancer-related death) was analyzed based on the KaplanMeier method. At the time of analysis, 53 patients had died from their head and neck cancer, one from chemotherapy side-effects, 20 from independent causes and seven from unknown causes. Influence of categorical variables on survival was tested by means of log-rank analysis. Analysis of continuous variables, as well as multivariate analyses, were analyzed according to the Cox proportional hazard regression model. In order to fit the Gaussian distribution, log 10 EGFR concentrations were considered for parametric analyses. Statistics were performed using SPSS software.
| Results |
|---|
|
|
|---|
Description of EGFR dinucleotide repeat polymorphism
The number of CA repeats was comprised between 15 and 22. Allelic distribution in tumors and normal tissues was trimodal, with the predominance of 16, 20 and 18 CA repeats. Allelic distribution in tumors was: 46.9% 16-CA, 17.9% 20-CA, 16.1% 18-CA, 10.3% 17-CA, 3.6% 21-CA, 3.1% 15-CA, 1.3% 19-CA and 0.9% 22-CA. In normal tissues, allelic distribution was: 47.1% 16-CA, 21.3% 20-CA, 14.4% 18-CA, 8.6% 17-CA, 4% 21-CA, 2.3% 15-CA, 1.1% 19-CA and 1.1% 22-CA. The frequency distribution of EGFR genotype in tumors is illustrated in Figure 1, and shows that homozygous 16-16 CA repeats was the most frequent genotype (26%). Heterozygosity was close between tumors and normal tissues (62.5% and 67.8% in tumors and normal tissues, respectively). For the 87 patients with EGFR genotype analyzed in both tumor and normal tissue, genotypes were superimposable except for six patients (one shorter allele in tumor for five patients, one longer allele for one patient).
|
EGFR genotypephenotype relationships
Tumoral EGFR expression exhibited a very marked interpatient variability, with concentrations ranging from 2 to 5260 fmol/mg protein (mean 383, median 128; n=111). EGFR concentrations in normal tissues varied from non-detectable up to 295 fmol/mg protein (mean 29, median 19; n=91). EGFR concentrations in tumors were positively correlated with EGFR expression in normal tissues (Spearman correlation, P <0.001, r=0.56; n=91).
Figure 2A and B illustrates the mean EGFR values as a function of EGFR genotype in tumors and normal tissues, respectively. EGFR concentrations were significantly higher in CA-repeat homozygous tumors as compared with heterozygous tumors (median were 214 and 108 fmol/mg protein, respectively; MannWhitney, P=0.024). In contrast, EGFR concentrations measured in normal tissues were not significantly different with respect to the heterozygocity status.
|
We further analyzed the possible relationships between tumoral EGFR genotype and phenotype using different approaches, since such an analysis is intrinsically difficult to perform because of the presence of the two alleles (Table 2). When splitting the overall population into three groups: patients with short repeats (two alleles <17; n=32) versus patients with long repeats (two alleles
17; n=31) versus remaining patients (intermediary cases; n=48), EGFR concentrations were not significantly different between the three groups (KruskalWallis, P=0.14), nor between the short and the long repeat groups (MannWhitney, P=0.33). In the subgroup of homozygous tumors (n=41), EGFR expression was not significantly different according to the length of the CA repeat (Spearman correlation, P=0.48). Interestingly, when considering the largest subgroup of tumors exhibiting a common allele (i.e. 76 tumors with at least one 16-CA repeats allele), we observed a significant decrease of EGFR expression with increasing length of the remaining allele (Spearman correlation, P=0.047, r= 0.23). In addition, when considering only the longer allele, the longer the CA repeat, the lower the EGFR expression (Spearman correlation, P=0.055, r=0.18). In contrast, EGFR expression was not linked to the length of the smaller allele.
|
No relationship was observed between EGFR expression and genotype measured in normal tissues (n=72 cases).
Relationships between EGFR genotype and tumor characteristics
Tumor staging and histologic differentiation were not related to EGFR genotype (by considering either the heterozygocity or the short/intermediary/long classification).
Survival analysis
Median specific survival was 46.9 months. Log-rank analyses demonstrated that specific survival was influenced by the performance status (0 versus 1 versus 23; P=0.0008), tumor localization (oro + hypopharynx versus larynx versus oral cavity; P=0.030), lymph node involvement (N0 versus N1 versus N2 versus N3; P=0.0075) and the tumor staging (II versus III versus IV; P=0.030). A multivariate Cox analysis showed that performance status and node involvement were the strongest independent predictors. Tumoral EGFR expression significantly influenced specific survival: the greater the EGFR expression, the poorer the survival (the risk of death increases by 1.75-fold when EGFR concentrations increase by 10-fold; Cox analysis, P=0.010) (Table 3). The prognostic value of EGFR expression remained significant in a multivariate analysis including performance status and node involvement (Table 3). In contrast, neither tumoral nor normal tissue EGFR genotype (whatever criteria considered) influenced specific survival (P >0.20) (Table 3).
|
| Discussion |
|---|
|
|
|---|
The human EGFR gene, located on chromosome 7p, codes for a 170 000 transmembrane protein that plays a pivotal role in cell proliferation, differentiation and survival. EGFR is frequently overexpressed in a wide variety of solid tumors, and thus represents an attractive target for innovative treatments [22
Clinical trials to evaluate EGFR-targeted therapies are actively being developed in head and neck cancer patients. This prompted us to analyze the dinucleotide repeat polymorphism in EGFR gene on an unselected consecutive group of 112 head and neck cancer patients. Our purpose was to analyze EGFR genotypephenotype relationships, as well as their respective prognostic values on patient survival. EGFR CA repeat polymorphisms were identical in normal and tumoral tissues for 93% of cases. In agreement with data reported in the literature in Caucasians [24
], we observed that the 16-CA allele was the most frequent, representing
47%, followed by the 20-CA and the 18-CA. The most frequent genotype was 1616 CA repeats. Unfortunately, the presence of two alleles (62.5% heterozygosity in tumors) and the large number of genotypes encoutered (23 classes in tumors) render the genotypephenotype relationships difficult to demonstrate. An attempt to classify tumors as short versus long versus intermediary CA repeats did not allow us to demonstrate a link between EGFR genotype and EGFR expression in tumors (Table 2). However, interestingly, focusing on the largest group of patients exhibiting a common allele (16-CA repeat, 76 patients), tumoral EGFR expression significantly decreases when the length of the remaining allele increases (P=0.047) (Figure 2A, Table 2), in line with the previous reported impact of intron 1 polymorphism on EGFR expression [19
, 20
, 25
]. Also, when considering the influence of the longer allele alone on the whole set of patients, a trend for a decreased EGFR expression was observed when the length of the longer allele increased (P=0.055) (Table 2). Such an approach, which consists of testing the influence of a single allele on EGFR expression, has already been reported by Buerger et al. [20
], who showed a similar influence of the shorter allele. Also, we presently observed on the whole set of patients that homozygous tumors exhibited two-fold higher EGFR expression on average as compared with heterozygous tumors (P=0.02) (Table 2). The fact that the majority of homozygous tumors were short 16-16 CA repeats (
2-test, homozygous/heterozygous versus short/intermediary/long repeats, P <0.001) may explain such an influence. This agrees with previous data reported by Buerger et al. [20
]. In total, the present data provide arguments in favor of some influence of CA repeat polymorphism on tumoral EGFR expression in head and neck cancer patients. In contrast, the present study did not reveal any influence of EGFR dinucleotide polymorphism on EGFR expression in normal tissues. This latter observation suggests that a pharmacogenetic explanation for the link between the intensity of cutaneous side-effects and anti-EGFR treatment effacy may not be relevant.
The second end point of the present study was to test whether EGFR CA repeat polymorphism had an impact on patient survival. Depending on the tumor characteristics, patients were treated with the therapeutic approaches currently used at time of patient recruitment (Table 1). Tumoral EGFR expression was a strong prognostic parameter of specific survival (the higher the expression, the shorter the survival; P=0.007) (Table 3), independent of performance status and node involvement, thus confirming previous data by others and ourselves [1
3
]. In contrast, CA repeat polymorphism did not influence specific survival, whatever the considered genotype classification (Table 3). A bivariate Cox analysis including both the short allele (
16 versus >16) and the long allele (
18 versus >18) confirmed that EGFR genotype was not related to specific survival (Table 3). EGFR expression as well as CA repeat polymorphism did not influence overall survival (data not shown). From the present data, it appears that a pharmacogenetic approach which consists of analyzing constitutionnal EGFR dinucleotide repeat polymorphism cannot replace the determination of tumor EGFR expression for predicting outcome in head and neck cancer.
The regulation of EGFR expression in head and neck tumors is complex and multifactorial. Among extrinsic influences, dietary factors [27
] and tumor predisposing factors like alcohol and tobacco use [28
30
] are involved. Among intrinsic factors, EGFR gene amplification cannot be ruled out, although this phenomenon is not frequently encountered in head and neck cancers (frequency
15%) [31
, 32
]. The present study suggests for the first time that EGFR gene polymorphism in intron 1 may be implicated, at least in part, in the regulation of EGFR expression in head and neck tumors. These preliminary results deserve further confirmation, with special attention paid to the sublocalizations of head and neck tumors.
| Notes |
|---|
M.-C. Etienne-Grimaldi and S. Pereira contributed equally to this work.
Received for publication November 23, 2004. Accepted for publication January 24, 2005.
| References |
|---|
|
|
|---|
1. Grandis JR, Tweardy DJ. Elevated levels of transforming growth factor alpha and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer. Cancer Res 1993; 53: 35793584.
2. Pomerantz GR, Grandis JR. The role of epidermal growth factor receptor in head and neck squamous cell carcinoma. Curr Oncol Rep 2003; 5: 140146.[Medline]
3. Etienne MC, Pivot X, Formento JL et al. A multifactorial approach including tumoural epidermal growth factor receptor, p53, thymidylate synthase and dihydropyrimidine dehydrogenase to predict treatment outcome in head and neck cancer patients receiving 5-fluorouracil. Br J Cancer 1999; 79: 18641869.[CrossRef][Medline]
4. Yarden Y. The EGFR family and its ligands in human cancer: signalling mechanisms and therapeutic opportunities. Eur J Cancer 2001; 37: 38.[Medline]
5. Arteaga CL. The epidermal growth factor receptor: from mutant oncogene in non human cancers to therapeutic target in human neoplasia. J Clin Oncol 2001; 19: 3240.
6. Ciardiello F, Tortora G. A novel approach in the treatment of cancer: targeting the epidermal growth factor receptor. Clin Cancer Res 2001; 7: 29582970.
7. Baselga J. Targeting the epidermal growth factor receptor: a clinical reality. J Clin Oncol 2001; 19: 4144.
8. Mendelsohn J. Targeting the epidermal growth factor receptor for cancer therapy. J Clin Oncol 2002; 20: 113.
9. Castillo L, Etienne-Grimaldi MC, Fischel JL et al. Pharmacological background of EGFR targeting. Ann Oncol 2004; 15: 10071012.
10. Soulieres D, Senzer NN, Vokes EE et al. Multicenter phase II study of Erlotinib, an oral epidermal growth factor receptor tyrosine kinase inhibitor, in patients with recurrent or metastatic squamous cell cancer of the head and neck. J Clin Oncol 2004; 22: 7785.
11. Crombet T, Osorio M, Cruz T et al. Use of the humanized anti-epidermal growth factor receptor monoclonal antibody h-R3 in combination with radiotherapy in the treatment of locally advanced head and neck cancer patients. J Clin Oncol 2004; 22: 16461654.
12. Trigo J, Hitt R, Koralewski P et al. Cetuximab monotherapy is active in patients with platinum-refractory recurrent/metastatic squamous cell carcinoma of the head and neck: results of a phase II study. Proc Am Soc Clin Oncol 2004; 23: 487 (Abstr 5502).
13. Ellis LM, Hoff PM. Targeting the epidermal growth factor receptor: an important incremental step in the battle against colorectal cancer. J Clin Oncol 2004; 22: 11771179.
14. Lynch TJ, Bell DW, Sordella R et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004; 350: 21292139.
15. Magné N, Fischel JL, Dubreuil A et al. Influence of epidermal growth factor receptor (EGFR), p53 and intrinsic MAP kinase pathway status of tumour cells on the antiproliferative effect of ZD1839 ("Iressa"). Br J Cancer 2002; 86: 15181523.[CrossRef][Web of Science][Medline]
16. Perez-Soler R. Can rash associated with HER1/EGFR inhibition be used as a marked of treatment outcome? Oncology 2003; 17: 2328.[CrossRef]
17. Bornstein P, McKay J, Liska DJ et al. Interactions between the promoter and first intron are involved in transcriptional control of alpha 1 (I) collagen gene expression. Mol Cell Biol 1988; 8: 48514857.
18. Gebhardt F, Bürger H, Brandt B. Modulation of EGFR gene transcription by secondary structures, a polymorphic repetitive sequence and mutationsa link between genetics and epigenetics. Histol Histopathol 2000; 15: 929936.[Web of Science][Medline]
19. Gebhardt F, Zänker KS, Brandt B. Modulation of epidermal growth factor receptor gene transcription by a polymorphic dinucleotide repeat in intron 1. J Biol Chem 1999; 274: 1317613180.
20. Buerger H, Gebhardt F, Schmidt H et al. Length and loss of heterozygosity of an intron 1 polymorphic sequence of egfr is related to cytogenetic alterations and epithelial growth factor receptor expression. Cancer Res 2000; 60: 854857.
21. Perea S, Oppenheimer D, Amador M. Genotypic bases of EGFR inhibitors pharmacological actions. Proc Am Soc Clin Oncol 2004; 23: 196 (Abstr 3005).
22. Vlahovic G, Crawford J. Activation of tyrosine kinases in cancer. Oncologist 2003; 8: 531538.
23. Lassman AB. Molecular biology of gliomas. Curr Neurol Neurosci Rep 2004; 4: 228233.[Medline]
24. Liu W, Innocenti F, Chen P et al. Interethnic difference in the allelic distribution of human epidermal growth factor receptor intron 1 polymorphism. Clin Cancer Res 2003; 9: 10091012.
25. Buerger H, Packeisen J, Boecker A et al. Allelic length of a CA dinucleotide repeat in the egfr gene correlates with the frequency of amplifications of this sequencefirst results of an inter-ethnic breast cancer study. J Pathol 2004; 203: 545550.[CrossRef][Web of Science][Medline]
26. Kersting C, Tidow N, Schmidt H et al. Gene dosage PCR and fluorescence in situ hybridization reveal low frequency of egfr amplifications despite protein overexpression in invasive breast carcinoma. Lab Invest 2004; 84: 582587.[CrossRef][Web of Science]
27. Brown NM, Wang J, Cotreno MS et al. Prepubertal genistein treatment modulates TGF-
, EGF and EGF-receptor mRNAs and proteins in the rat mammary gland. Mol Cell Endocrinol 1998; 144: 149165.[CrossRef][Web of Science][Medline]
28. Barsky SH, Roth MD, Kleerup EC et al. Histopathologic and molecular alterations in bronchial epithelium in habitual smokers of marijuana, cocaine, and/or tobacco. J Natl Cancer Inst 1998; 90: 11981205.
29. Crowe DL, Hacia JG, Hsieh CL et al. Molecular pathology of head and neck cancer. Histol Histopathol 2002; 17: 909914.[Web of Science][Medline]
30. Ye YN, Liu ES, Shin VY et al. Nicotine promoted colon cancer growth via epidermal growth factor receptor, c-Src, and 5-lipoxygenase-mediated signal pathway. J Pharmacol Exp Ther 2004; 308: 6672.
31. Rodrigo JP, Ramos S, Lazo PS et al. Amplification of ERBB oncogenes in squamous cell carcinomas of the head and neck. Eur J Cancer 1996; 32A: 20042010.[CrossRef][Web of Science][Medline]
32. Nagatsuka H, Ishiwari Y, Tsujigiwa H et al. Quantitation of epidermal growth factor receptor gene amplification by competitive polymerase chain reaction in pre-malignant and malignant oral epithelial lesions. Oral Oncol 2001; 37: 599604.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. Bergh Quo Vadis With Targeted Drugs in the 21st Century? J. Clin. Oncol., January 1, 2009; 27(1): 2 - 5. [Full Text] [PDF] |
||||
![]() |
G. Milano, M.-C. Etienne-Grimaldi, L. Dahan, M. Francoual, J.-P. Spano, D. Benchimol, M. Chazal, C. Letoublon, T. Andre, F.-N. Gilly, et al. Epidermal growth factor receptor (EGFR) status and K-Ras mutations in colorectal cancer Ann. Onc., December 1, 2008; 19(12): 2033 - 2038. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Graziano, A. Ruzzo, F. Loupakis, E. Canestrari, D. Santini, V. Catalano, R. Bisonni, U. Torresi, I. Floriani, G. Schiavon, et al. Pharmacogenetic Profiling for Cetuximab Plus Irinotecan Therapy in Patients With Refractory Advanced Colorectal Cancer J. Clin. Oncol., March 20, 2008; 26(9): 1427 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hopkins, D. W. Cescon, D. Tse, P. Bradbury, W. Xu, C. Ma, P. Wheatley-Price, J. Waldron, D. Goldstein, F. Meyer, et al. Genetic Polymorphisms and Head and Neck Cancer Outcomes: A Review Cancer Epidemiol. Biomarkers Prev., March 1, 2008; 17(3): 490 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wacker, T. Nagrani, J. Weinberg, K. Witt, G. Clark, and P. J. Cagnoni Correlation between Development of Rash and Efficacy in Patients Treated with the Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor Erlotinib in Two Large Phase III Studies Clin. Cancer Res., July 1, 2007; 13(13): 3913 - 3921. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-S. Wang, P.-M. Chen, T.-J. Chiou, J.-H. Liu, J.-K. Lin, T.-C. Lin, H.-S. Wang, and Y. Su Epidermal Growth Factor Receptor R497K Polymorphism Is a Favorable Prognostic Factor for Patients with Colorectal Carcinoma Clin. Cancer Res., June 15, 2007; 13(12): 3597 - 3604. [Abstract] [Full Text] [PDF] |
||||
![]() |
S-H. Ou, J. Zell, A Ziogas, and H Anton-Culver Epidemiology of nasopharyngeal carcinoma in the United States: improved survival of Chinese patients within the keratinizing squamous cell carcinoma histology Ann. Onc., January 1, 2007; 18(1): 29 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Brandt, S. Meyer-Staeckling, H. Schmidt, K. Agelopoulos, and H. Buerger Mechanisms of egfr Gene Transcription Modulation: Relationship to Cancer Risk and Therapy Response Clin. Cancer Res., December 15, 2006; 12(24): 7252 - 7260. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kalyankrishna and J. R. Grandis Epidermal Growth Factor Receptor Biology in Head and Neck Cancer J. Clin. Oncol., June 10, 2006; 24(17): 2666 - 2672. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Francoual, M.-C. Etienne-Grimaldi, J.-L. Formento, D. Benchimol, A. Bourgeon, M. Chazal, C. Letoublon, T. Andre, N. Gilly, J.-R. Delpero, et al. EGFR in colorectal cancer: more than a simple receptor Ann. Onc., June 1, 2006; 17(6): 962 - 967. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





